Why do realgar and orpiment form together?

Q: Labeo is said to be physostomous. Why ?

A: Labeo is a genus that belongs to the family Cyprinidae. This genus consists of carps which include…

Q: What is triticale  ?

A: Hybrid plants are produced when plant breeders intentionally cross-pollinate the two different…

Q: What is the physiologicalcause of the syndrome knownas cretinism?

A: Creatinism is a hormonal disorder which occurs in the children. It is characterized by stunted…

Q: Define renin

A: Renin was first discovered by Tigerstedt and Bergman in 1898 in the saline extracts of rabbit…

Q: What is the importance of meosis

A: Answer: CELL DIVISION : Cell division is the process during which a cell gives rise to new daughter…

Q: Define MRN complex,

A: MRN complex is a protein Complex consisting of : Mre11 Rad50 Nbs1

Q: affect the nucleus?

A: Vincristine have the ability to binds with the microtubular proteins of the mitotic spindle, which…

Q: Why would a loss of dystrophin protein cause weakness and a loss of coordination?

A: Introduction Dystrophin is a vital linker protein responsible for the protection and stability of…

Q: Define biliverdin

A: Erythrocytes or Red blood cells undergo a continuous breakdown known as hemolysis. Erythrocytes…

Q: what are centrioles?

A: Centrioles are found in most of the eukaryotic  cells.  Centrioles are surrounded by pericentriolar…

Q: What is lac operan

A: The information stored in the genes is decoded for the synthesis of a functional protein by a…

Q: 1. Epidermis of skin 2. Lining of kidney calyces 3. Peritoneum

A: Epithelial tissues are present as lining of external internal and exposed parts of the body , open…

Q: Expand the following : i) GIFTii) ICSIiii) IUCD

A: GIFT is a technique in which male and female gametes are directly injected into the fallopian tube…

Q: What does heterogeneous mean in medical terms and What does heterogeneous mean in ultrasound?

A: Generally, the term "heterogeneous" denotes a process involving substances in different phases or a…

Q: What is Xyy?

A: Chromosomes are defined as the thread-like structures that carry genetic information. In humans, 23…

Q: What is the natural function ofPTEN?

A: Phosphatase and (PTEN) tensin homolog is considered as a protein complex, which is encoded by gene…

Q: W| Fe Home Insert Page Layout References Mailing Review Page 2 of 2 Words: 269 # English (US) Type…

A: Introduction :- The smooth endoplasmic reticulum (SER) is a type of organelle found in eukaryotic…

Q: What are STIs?

A: Infection is caused by entry, growth and multiplication of a causative agent. The causative agent…

Q: What does the word "deppresion" really mean

A: Depression is a mental health disorder that affects a person's mood, thoughts, and behavior. It is a…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Define pleitropy

A: A gene is a sequence of nucleotides in genome that codes for a functioning molecule. There is…

Q: If the estimated basic reproductive rate Ro for a novel density-dependent infection is 5, what…

A: R0 =5 pc= 1- (1/R0) pc=  1 - 0.2 pc= 0.8 = critical vaccination threshold for the population

Q: Define unipolar leads?

A: Unipolar leads are used in the ECG Electrocardiograph. Electrocardiograph or ECG is a procedure…

Q: what is Rotor Syndrome?

A: Bilirubin is a substance that is formed by the breakdown of heme containing products like red blood…

Q: What is Perforin?

A: The liquid medium within a cell is known as the cytosol. A component of the cytoplasm is the…

Q: What is thigmotropism?

A: Thigmotropism - The movement of a plant when it comes in contact with any support like pea plant…