Why is working with sticky ends easier compared to working with blunt ends? O sticky ends take advantage of usual base pairing Osticky-ended fragments can be inserted anywhere in the vector O blunt-ended fragments can be inserted anywhere in the vector o blunt ends take advantage of usual base pairing
Q: 2. Discuss an enzyme/enzymes that can use different mechanisms action depending environment.…
A: When an enzyme catalyzes a reaction that involves two substrates and after catalysis, there are two…
Q: Why is yeast used as a source of RNA? Explain in 1-3 sentences
A: Yeasts have around 6% of total biomass as RNA, this is the highest amount of RNA content among all…
Q: a. Which of the following is the structure of 4- ethoxyaniline?
A: Answer; Phenacetin is an analgesic formed by the reaction between 4-ethoxy aniline and acetic…
Q: Here is the cartoon representation and Ramachandran plot of a small DNA-binding protein, 80-residues…
A: The Ramachandran plot marks the and angles of amino acid residues in a protein. Their are certain…
Q: What is the difference between froth test and foam test?
A: Foam and froth tests evaluate stability and quality. Both terms are used interchangeably but refer…
Q: i) Draw the first step of lipid hydrolysis using water as a nucleophile OO-P-O LOR₂ OR₁
A: Phospholipids are a type of lipid that is found in cell membranes. A glycerol molecule is connected…
Q: What is the effect of insulin on the committed step of glycolysis in the liver? Describe the…
A: In the liver, insulin can affect the committed step of glycolysis through its impact on the activity…
Q: Examine the following shorthand nomenclature of the fatty acids: Lipid A: 20:n-3 Lipid B: 20:2n-3…
A: Fatty acids are carboxylic acids with long aliphatic chains that can be saturated or unsaturated.…
Q: Identify a polar bond within carbohydrate molecule and partial changes to the atoms
A: Carbohydrates are macronutrients that are composed of carbon, hydrogen and oxygen atoms. They are…
Q: What are the specific E. coli strains used to make competent cells? Explain the characteristics of…
A: Competent cells are the ones that are prepared to easily take-up modified plasmids (containing…
Q: strate about the Map and sequence the genomes of several model organisms used in experimental…
A: In genetics, molecular biology, and in various research genome mapping is important. It is basically…
Q: In sheep DNA, the mol % of adenine (A) was found to be 28.3. Based on Chargaff's rule, what would be…
A: The base pairs in DNA have specific proportions according to Chargaff's rule. The quantity of…
Q: Explain why breathing in a brown bag paper helps with hyperventilation. Explain using Le Chatelier's…
A: Le Chatelier's Principle explains why breathing into a brown paper bag can help manage…
Q: A. The aldaric acid of D-mannose is the same as the aldaric acid of which sugar? B. The aldaric acid…
A: A. The Aldaric acid of D-mannose is same as the aldaric acid of D-mannose (since only D-mannose is…
Q: The active site of an enzyme binds specifically to a substrate. Your text mentions an early idea…
A: Enzymes are high molecular weight proteins molecules that catalyse biochemical reactions. The…
Q: Consider the 20 standard amino acids and their structures. Choose a set of 6 amino acids that you…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 15.18) Determine whether the following statements describe insulin, glucagon, or both insulin and…
A: Insulin and glucagon are hormones that play a crucial role in regulating the levels of glucose in…
Q: 11. Which of the following best describes what happens when hemoglobin binds bisphosphoglyceric acid…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Hormonal Control of Carbohydrate Metabolism (Section 7-9) 7-107 What effect does insulin have on…
A: Carbohydrate metabolism is under stringent hormonal control. The type of hormone released, dictates…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…
Q: Blood sugar homeostasis: Indicate the order of events that will happen following blood glucose…
A: After a meal, blood glucose increases. To maintain blood glucose level, insulin is released by the…
Q: The hydrolysis of glycogen to yield glucose is catalyzed by the enzyme phosphorylase. Caffeine,…
A: Glycogen phosphorylase is an enzyme that catalyzes the breakdown of glycogen into…
Q: Define: simple diffusion, facilitated diffusion, primary active transport, secondary active…
A: simple diffusion: Nonpolar molecules move across concentration gradient (downhill process) in an…
Q: analyzing sequencing data, what parameters should be considered?
A: Genomic research has been transformed by improvements in DNA sequencing technology, which have made…
Q: 1. Which of the following is NOT innervated by the parasympathetic nervous system? a. salivary…
A: The nervous system is a collection of specialised cells that control movement, thought, sensation…
Q: Explain why breathing in a brown bag paper helps with hyperventilation. Explain using Le Chatelier's…
A: Le Chatelier's Principle explains why breathing into a brown paper bag can help manage…
Q: A protein contains 342 amino acid residues. Assuming that the whole protein is in alpha- helical…
A: Alpha-helix is one of the most prominent secondary structures in proteins. In an alpha-helix, length…
Q: State the steps of the beta-oxidation pathway. Please make sure to state all the enzymes and…
A: Beta oxidation (also β-oxidation) is the process by which fatty acids are broken down. Both…
Q: Identify the following electron transport intermediate. H : O : O : H A.…
A: Electron transport refers to the movement of electrons through a series of membrane-bound protein…
Q: 15.4) a) Name the products of the dephosphorylation of ATP reaction shown below. NOTE: You do not…
A: Dephosphorylation of ATP (adenosine triphosphate) is the process of removing a phosphate group from…
Q: For the scenario below relating to Glycogenolysis, please explain how glucose release would be…
A: Glycogen is a macromolecule which acts as a storage of glucose in our body. It is a highly branched…
Q: Figure 3 shows the results of an oral glucose tolerance test (OGTT) from a subject with diabetes.…
A: Oral glucose tolerance test is a test to measure the response of body to the glucose it intakes. It…
Q: Match the correct answers in column A with column B + Prepare the protein samples with SDS sample…
A: Gel electrophoresis adds another layer to electrophoresis that allows the separation of charged…
Q: 14. What are the functions of nucleic acids? Please explain
A: Nucleic acids store, transmit, and express genetic information. They're essential to life. Nucleic…
Q: Fatty acid beta-oxidation consists of 4 steps that are repeated multiple times. Explain the purpose…
A: Fatty acid beta-oxidation is a metabolic process that occurs within the mitochondria of cells and…
Q: 15.17) How many ATP can be produced from the catabolism of one glucose molecule when the two NADH…
A: The main source of energy is carbohydrates. Glucose is metabolized in the cells to give energy in…
Q: Which of these compounds undergo keto-enol tautomerism? (Select all that apply.) O CH3CCH3 CH3 CH3…
A: Tautomers are structural isomers of each other. Keto-enol tautomerism is a type of constitutional…
Q: Which carbons would contain the radioactive-labeled in the isoprene produced by the mevalonate…
A: Let's go step by step to determine which carbons would contain the radioactive-labeled carbon in the…
Q: What ion or ions are required for PYC activity? What ion or ions inhibit PYC activity? Remember,…
A: The reaction catalyzed by pyruvate carboxylase (PYC) is given below. Pyruvate + HCO3- + ATP →Mg2+ ,…
Q: Explain the reaction that is shown with the scheme below by your words.
A: Enzymes are proteins that are responsible for catalyzing biological reactions. They have an integral…
Q: Treatment with NAD for hangovers: possible? Explain?
A: NAD, or nicotinamide adenine dinucleotide, is a coenzyme found in all living cells. It is involved…
Q: What is lipid phosporylation?
A: Phosphorylation is a chemical process that adds a phosphate group to a molecule, most commonly a…
Q: How many net ATP would be produced in these liver cells from the complete oxidation of 1 molecule of…
A: The ATP synthase is an enzyme present in the inner membrane and cristae of mitochondria. It is a…
Q: Explain acid reaction
A: Acids are substances that can donate hydrogen ions (H+) when dissolved in water, resulting in an…
Q: Which of these enzymes is NOT associated with the inner mitochondrial membrane? All of these enzymes…
A: Mitochondria is the power house of the cell. It has two membranes and a matrix. It even has its own…
Q: Please explain all the variables used in your diagram in detail.
A: The given diagram is of altered calcium signaling pathway due to beta amyloid aggregation in…
Q: Nicotiana tabacum cells are cultured to produce a polysaccharide gum. The reactor used is a…
A: The system or any device which provides a controlled environment for the growth of the…
Q: The most efficient enzymes are characterized by the following value: KM is a small number.…
A: kcat/KM is near the diffusion-controlled limit: An efficient enzyme is expected to have a kcat/KM…
Q: . The induced fit conformational change in hexokinase occurs when— the allosteric site is…
A: Hexokinase is the enzyme found in the cytoplasm that catalyses the addition of phosphate to glucose…
Q: 12. Which of the following statement about coenzymes is not correct? The adenosine monophosphate…
A: Enzymes are proteins that catalyse biochemical reactions. Sometimes enzymes require a non-protein…
Step by step
Solved in 3 steps
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow indicates the direction for migration of the bands in the gel. What are the first 3 letters of this DNA sequence?. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
- How much 340bp insert DNA should be added to a ligation in which 50ng of 4.3kb vector will be used? The desired vector: insert molar ratio needs to be 1:3.28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…I currently have 6 stock plasmids that all have 2ug of material at 50ng/ul with a volume of 200ul each. How do I make a dilution from the stock with a volume of 1mL?
- oner micro mole of 48 nulceotide dna was synthesised via solid phase .this sample contains salts and dna strands in different lenghts(32-48)nt.what can be possible procedure and instruments to purify and conform only 48 nt dna from the mixture.You have two sewage samples that you want to check for the SARS Cov 2 viral load. Whichvariable would give you a good estimate?a. High Ct valueb. Low Ct valuec. High melting temperatured. Low melting temperaturee. None of the above The DNA fragments generated during a cycle sequencing reaction are separated by sizes usingcapillary gel electrophoresis. The determination of the actual sequence is based on detection ofa. fluorescently labelled ddNTPsb. the lengths of the fragmentsc. fluorescently labelled probesd. fluorescently labelled primers.You have isolated a fragment of viral DNA that supposedly encodes for two proteins, 196 and 220 amino acids long respectively. The isolated DNA fragment is found to be 1100 base pairs in length. Argue why is the isolated DNA cannot code the two proteins identified earlier?
- What compounds remain in the ethanol solution after the DNA is removed bt spooling onto a glass rod?Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the fragments produced by the pure 1.3-kb fragment? (might have to show diagram)Two particular contigs are suspected to be adjacent, possibly separated by repetitive DNA. In an attempt to linkthem, end sequences are used as primers to try to bridgethe gap. Is this approach reasonable? In what situationwill it not work?