Why might a person make bad personal or lifestyle choices if she had knowledge of her genome?

Q: What is Torsional Stress in DNA?

A: DNA can be regarded as the double stranded information sequence or as a chemical compound subjected…

Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…

A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…

Q: Why is it 2n-2?

A: A molecule is called chiral molecules if it cannot be superposed on its mirror image by any of A…

Q: What statement about DNA polarity is TRUE?

A: Two complementary chain of nucleotides makes up DNA. A nucleotide is formed by nitrogenous base,…

Q: How is the information in the DNA interpreted into a functional protein,such as an enzyme?

A: Deoxyribonucleic or DNA can be described as the complex biomolecule that contains biological…

Q: What are conjugate proteins? How are the classified?

A: Proteins are the building blocks of a body and play viral role in providing structure to cell and…

Q: What is The crucial role of base pairing betweencodon and anticodon?

A: The triplet code expresses the genetic information that is transcribed into mRNA. The tRNA translate…

Q: What is Simple sequence repeat?

A: The genome of every individual contains millions of genetic variation or variants which make each…

Q: What is an anticodon, and on what kind of nucleic acid is it found?

A: An anticodon is a three-letter sequence; one which is complementary, to the codon sequence found in…

Q: Approximately how many nucleotides and genes are contained in the human genome?

A: The complete set of genetic material present in an organism is called a genome. The genome consists…

Q: What is an intron?

A: The genetic information of all living organisms is stored in the DNA. The specific sequence of DNA…

Q: What is the meaning of the term genetic material?

A: The genetic material is important for all organism. In eukaryotes, the genetic material is enclosed…

Q: What is the terminator?

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…

A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…

Q: How is a protein with a proper sequence generated?

A: Amino acids are biomolecules made up of two functional groups: an amino group (-NH2) and a carboxyl…

Q: According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine…

A: Since you have asked multiple question, we will answer only the first question for you. If you want…

Q: What is Exons C

A: Exons are nucleotide sequences in DNA and RNA that are conserved in the creation of mature RNA.…

Q: hat is the 21st amino acid? Explain

A: The amino acid is generally 20 in numbers. These amino acid residues are incorporated into the…

Q: According to the Watson- Crick model how many polynucleotide chains does a DNA molecule have?

A: The Watson-Crick Model of DNA is a double-stranded, helical molecule. It consists of two…

Q: Provide an explanation for why in DNA, the base G is always base paired with C and A is always base…

A: DNA is a double layered structure. The double helix model is explained by Watson and Crick. The two…

Q: What distance separates base-pairs in the Watson-Crick model of DNA? O 2.3Å O 3.4Å O 4.5Å O 5.6Å

A: DNA is a double helix structure that is made up of two long strands that are coiled around a central…

Q: When is a DNA sequence said to be conserved?

A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are the two important classes of nucleic…

Q: Adenine is a niterogenous base or nucleosides?

A: Adenine is a important component of nucleic acids . It is a type of purine. It contains 5 nitrogen…

Q: Why exactly are the bases T-G or A-C not complementary?

A: Nucleotides in a base pair are complementary, that means their shape allows them to bind with…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: What are the base-pairing rules?

A: The nucleotides present in the DNA are known as base pairs. There are a total of four base pairs -…

Q: How is the reading frame of a nucleotide sequence set?

A: A reading frame is a nucleotide triplet sequence that may be translated into a polypeptide and is…

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can…

Q: What is paramutation? What are the key features of this phenomenon?

A: The interaction of the alleles residing in the same locus and one of the alleles is capable of…

Q: What is a nucleotide triplet?

A: “Nucleotides” are the “building blocks” of the “genetic material” (DNA and RNA). They are composed…

Q: Why is a methylated base employed in DNA and not in RNA?

A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…

Q: Why can't there be more than two complementary primers?

A: The two primers used in PCR should not be complementary, or they will anneal to each other and form…

Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…

A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…

Q: What are Okazaki fragments? Why are they formed?

A: DNA replication is the process by which double-stranded DNA is copied to produce two identical…

Q: Why is rRNA so suitable for determining relatedness?

A: Cells form life's basic unit. A cell has different macromolecules, including carbohydrates,…

Q: I only need letter D

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: What is the effect of the altered amino acid sequence in Hb S that causes the cells to form sickle…

A: Introduction: Sickle cell anemia is an inherited disorder in which the shape of red blood cells…

Q: Whta is a homolog of a DNA ?

A: Homology refers to the similarity between a pair of structures or genes in different taxa due to…

Q: What are the bonds that are broken during the chemical reaction that results from the activity of…

A: There are two types of bonds present in the DNA double helix i.e. covalent and hydrogen. Covalent…

Q: What four general characteristics must the genetic material possess?

A: Genetics is a branch of biology that deals with genes, heredity, and variation. Heredity purely…

Q: In a segment of DNA consisting of 1000 nitrogen bases, 28% of which are thymine, how many bases are…

A: The majority of the cells have DNA as the genetic material. DNA is transmitted from the parents to…

Q: What is the full-form of DNA?

A: The living cells and organisms reproduce and transmit the characters from generation to generation.…

Q: what is an allosteric site?

A: Enzyme is a catalyst that helps in accelerating chemical reactions. To undergo chemical reaction,…

Q: What is the meaning of the statement “The code is redundant but not ambiguous?”.

A: Base-pair substitution, deletion, or addition constitutes a mutation in a gene. The effect of such…

Q: How many base pairs are changed in the sickle cell mutation?

A: in sickle-cell anemia, the gene for beta globin is mutated. As a result the mutated protein is…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.