Q: A mature sporophyte is: O unicellular O multicellular
A: Ans: Plants, algae, protists undergo an alternation between haploid and diploid states in order to…
Q: How does vasodilation reduce the body temperature?
A: Body temperature is maintained by the center present in the form of the hypthalamus. Hypothalamus is…
Q: Alice has type A blood and her husband Mark has type B blood. Their first child, Amanda, has type O…
A: The ABO blood group system is an example of co-dominance. It consists of three alleles that are…
Q: Name the products of the citric acid cycle.
A: The citric acid cycle is also known as the TCA cycle. The TCA cycle occurs inside the mitochondrial…
Q: What are some of the major human enzymes, structure, and proteins needed for SARS-CoV-2 replication…
A: The family of positive-sense, single-stranded RNA-enclosed viruses known as coronaviruses (CoVs) is…
Q: Describe Narwhals and state some great facts and interesting trivias about them.
A: Narwhals It is a medium sized toothed whale. It possess a large tusk from the protruding canine…
Q: Describe significant changes in the musculoskeletal system with aging.
A: Introduction The aging of cells can be attributed to several factors such as degradation of cellular…
Q: Write the overall chemical equation for glycolysis, noting the starting and ending products and…
A: Cellular respiration is the oxidation of nutrients in presence of oxygen.
Q: 1. A bacterium that does not have all the enzymes of central metabolism: a. Will not be a viable…
A: Bacteria are common, single-celled, free-living creatures. They are prokaryotic microbes. Bacteria…
Q: may u break it down a little more please
A: Integumentary system : Integuments are the largest system of the body. It includes skin and its…
Q: Z Primate Opposable Thumb? Length of Thumb (cm) Claws or Nails?
A: A primate is any mammal of the group that includes lemurs, lorises, tarsiers, monkeys, apes, and…
Q: _____ tissues are sheetlike with one free surface. a. Epithelial c. Nervous b. Muscle d. Connective
A: Tissues are the group of cells that are determined to carry out a specific function. These are of…
Q: The tetrapeptide Cys-Trp-Lys-Pro was digested with chymotrypsin and adjusted to pH=0.5 to fully…
A: Each protein or peptide is made up of a linear sequence of amino acids. The primary structure of a…
Q: Explain the following areas about (Types of laboratory devices) 1. Who makes up the device or what…
A: Device - Hot Air Oven Hot air oven is mainly used for following purposes . Dry sterilization…
Q: Case Study: Case Study: Catalase Activity Catalase HO2 (0 + O, (9) Catalase is an enzyme that…
A: Enzymes are catalysts of biological systems that are used to accelerate the rate of a chemical…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: 5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine…
A: In case of eukaryotic organism, cell containing nucleus, the cell cycle is categorized into two two…
Q: Describe the parts of an atom and where they arefound within the atom.
A: Atom is the smallest part of an object and is made up of different parts that determines the overall…
Q: What is the difference between direct and indirect measurements of metabolic rate? Recognize…
A: Introduction Metabolic rate means at which metabolism occurs in a living organism. Metabolic rate is…
Q: When the mammalian brain compares the actual temperature of the body to the preferred temperature of…
A: The cerebrum, brainstem, and cerebellum make up the brain. It is in charge of the majority of the…
Q: Explain how signals can specifically target only some cells, even if they are released into the…
A: Cells are structural and functional units of the body. The cells having similar shapes and sizes are…
Q: Need help with question one
A: The plasmid is the extrachromosomal DNA present in the bacterial cell. These are the extra DNA other…
Q: How could control of the glow trait be ultimately determined?
A: Introduction Genes are the hereditary units present on the chromosomes, these genes encode specific…
Q: Discuss how modern agriculture can be changed to minimize environmental impacts.
A: The ways in which modern agriculture can be changed to minimize environmental effects are-…
Q: particular monogenic trait has 5 different variants. Explain how you might determine the inheritance…
A: Introduction Let's first break down the word to understand what is monogenic. "Mono" men "single"…
Q: All the following statements support the theory that similar organisms have a common ancestor except…
A: Introduction The change in the heritable characteristics in a population over a period is termed…
Q: Explain the Calvin cycle in photosynthesis
A: Photosynthesis is the process in which solar energy is used to synthesize complex carbon compounds.…
Q: If you needed blood and the doctor told you, "Hey, you're lucky. You can take any ol' type of…
A: The blood cells of every different individual have a unique set of antigens present in the cell…
Q: Is the population in Hardy Weinberg equilibrium? (show your work) In your answer, describe what this…
A: Introduction Evolution is a term that relates to change. It is a continuous process that allows the…
Q: he Krebs cycle occurs in the Select one:
A: The Krebs cycle or TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle is a sequence of…
Q: How do the activities of exercising, voluntary hyperventilation, and breathing into a bag for a few…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Two parental strains with mean heights of 64.29 and 135 cm. respectively were crossed. The F1 and F2…
A: Polygenes are groups of genes that are expressed together. The character is controlled by multiple…
Q: Harry Potter speaks parseltongue (he can talk to snakes). Dumbledore explains that this is because…
A: Introduction Gene is the basic structural and functional unit of heredity. Gene controls all the…
Q: biotechnology: -define biotechnology -list 10 products of biotech found in our home
A: Q. Define biotechnology Q. list 10 products of biotech found in our home
Q: Assuming the technology and expertise is ready and available, which specific human/animal/world…
A: Introduction Unlike eukaryotic cells in plants and animals, prokaryotic cells such as bacteria and…
Q: List three major steps that are hypothesized to have occurred in the evolutionary history of…
A: Photosynthesis occurs in plants and some green algae. This occurs due to the presence of chlorophyll…
Q: post-transcriptional modifications that occur in mRNA and tRNA.
A:
Q: Which of the following species is prokaryotic? A. Mus muculus B. Arabidopsis thaliana C.…
A: Prokaryotes - these are the organisms whose cells lack a nucleus and other organelles. Prokaryotes…
Q: What are the functions of saliva?
A: Saliva is a clear liquid secreted by the salivary glands present in the mouth region. The saliva…
Q: Which of the following must be available in sufficient supply for glycolysis to proceed? a.…
A: Introduction Glycolysis is the process where glucose is broken down to form pyruvate and energy.…
Q: Each level of biological organization has emergent properties that arise from the interaction of its…
A: Emergent properties are those that arise from the interaction of component parts. In biology,…
Q: Maximum of 5 sentences: a. What limits a size of the cell and why? b. Describe the relationship of…
A: Introduction The fundamental building blocks of life are microscopic structures called cells. Even…
Q: What is esophageal atresia?
A: Esophageal atresia is a congenital birth defect of the esophagus that is swallowing tube that…
Q: Explain the following areas about (ultrasound device) 1. What are the ingredients the device? 2.…
A: To inspect interior body structures, an ultrasonic scan is employed. High-frequency sound waves are…
Q: concise timeline of events that happened in the early history of developmental biology
A: The branch of science that is responsible for the studies into various process that aids in the…
Q: What level of protein structure is hexameric insulin?
A: The pancreas has a very important role in the body. It can function as endocrine as well as…
Q: What's the primary difference between adult stem cells and embryonic stem cells? O A. Adult stem…
A: Stem cells have the capacity of generating different types of cell types that have different…
Q: Which of the following characteristics is shared by all types of muscle tissue? Question 5…
A: Introduction: Movements in the human body are controlled by muscle cells. Involuntary and voluntary…
Q: What are the importance of evolutionary concepts? Explain in 3 paragraphs
A: The idea of evolution is to present that how species evolved or developed. According to this…
Q: Questions to Answer: 1. What is a buffer solution? And what are its composition?
A: An acid may be defined as a substance which, when dissolved in water, produces hydrogen ions [H+] or…
Step by step
Solved in 2 steps
- Which of the following plant structures is not a defense against herbivory? a. thorns b. spines c. nectar d. alkaloidsThe dark forest floor is suitable for most carnivorous plants. Is there a link between carnivory and being able to thrive in the shade?Give any two examples of defense mechanism in plants against herbivory?
- What are three ways in which plants have evolved to reduce their risk of being killed by herbivores?why do we need to know if an area is suceptible for herbivory and what is the indication if an area has high percentage of herbivory?Which of the following is most likely NOT an example of a plant defense to herbivory? Lignin in the tissues Urushiol production (e.g. in poison ivy) Coconut husk
- If only a fraction of the energy that the herbivore gets from plant food becomes part of the herbivore’s body, what happens to the rest of it?How might humans interact with the system of insect infestation in tomatos in order to produce plants with a strong defense against insect infestation (simply answer please)Production of _____ would directly prevent herbivory. Select one: a. aerenchyma b. glutathione c. jasmonic acid d. nicotine e. carotenoids
- What are some ways in which plants defend themselves from herbivores? Describe two physical defenses and two chemical defenses.Which statement would the author most likely agree with? A)there are to many species of carnivorous plants. B)There are too few plant species in the world C)only a small number of plants are carnivorous D) a majority of plants are carnivorousIf human beings were the last component in this food chain, what would be the consequences of reduced nutrient supply to plants?