5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine will be covalently incorporated into the cell's DNA during replication. The radioactive DNA can be detected in the nuclei of individual cells by autoradiography (i.e.. by placing a photographic film over the cells, radioactive cells will activate the film and show up as black dots when looked at under a microscope). During whatphase of the cell cycle will the radioactive thymidine be incorporated? Why?

5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine will be covalently incorporated into the cell's DNA during replication. The radioactive DNA can be detected in the nuclei of individual cells by autoradiography (i.e.. by placing a photographic film over the cells, radioactive cells will activate the film and show up as black dots when looked at under a microscope). During whatphase of the cell cycle will the radioactive thymidine be incorporated? Why?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter10: Cell Division And Mitosis

Section: Chapter Questions

Problem 8TYK: Which of the following statements about cell cycle regulators is incorrect? a. The concentrations of...

See similar textbooks

Similar questions

Which of the following events does not occur during some stages of interphase? DNA duplication organelle duplication increase in cell size separation of sister chromatids
Compare the chromosome content of daughter cells following mitosis with that of the parent cell before its chromosomes were duplicated.
The first level of DNA organization in a eukaryotic cell is maintained by which molecule? cohesin condensin chromatin histone
Which of the following statements about cell cycle regulators is incorrect? a. The concentrations of cyclins change throughout the cell cycle. b. Cyclins are present in all stages of the cell cycle except S. c. Cyclin-Cdk complexes phosphorylate target proteins. d. Cdks combine with cyclin to move the cycle into mitosis. e. During anaphase of mitosis, cyclin is degraded, allowing mitosis to end.
A major difference between hereditary information in eukaryotes and prokaryotes is: a. in prokaryotes, the hereditary information is distributed among individual, linear DNA molecules in the nucleus. b. in eukaryotes, the hereditary information is encoded in a single, circular DNA molecule. c. in prokaryotes, the hereditary information is usually distributed among multiple circular DNA molecules in the cytoplasm. d. in eukaryotes, the hereditary information is distributed among individual, linear DNA molecules in the cytoplasm. e. in eukaryotes, the hereditary information is distributed amoung individual, linear DNA molecules in the nucleus.
1.In which phase of the cell cycle are DNA mutations most likely to occur? A.S Phase B.G1 Phase C.G2 Phase D.Prophase 2.Which of the following contains all of the components of a nucleotide? A.Sugar, phosphate, base B.Sugar, amino acid, base C.Amino acid, phosphate, base D.Sugar, phosphate, amino acid 3.What is meant by the description “antiparallel” regarding the strands that make up DNA? A.The 5’ to 3’ direction of one strand runs counter to the 5’ to 3’ direction of the other strand. B.The twisting nature of DNA creates nonparallel strands. C.Base pairings create unequal spacing between the two DNA strands. D.One strand is positively charged and the other is negatively charged.
1. A defective white blood cell does not complete the process of DNA replication. Which of the following is most likely to occur during the cell cycle for this cell? a. The white blood cell will be stopped at the G1 checkpoint and sent to the G0. b. The G2 checkpoint will stop the cell from continuing in the cell cycle. c. The white blood cell will get stuck at the spindle checkpoint. d.The cell will continue on to cytokinesis. 2. Which of the following statements describes how the RNA sequence specifies the production of an amino acid chain? a. Each set of three bases codes for an RNA molecule that specifies the anticodon. b. Each set of three bases codes for a single amino acid. c. Each base codes for one amino acid. d. Each group of three bases codes for an enzyme that binds amino acids together. 3. What will most likely happen when the -35 element and pribnow box are mutated? a. RNA Polymerase II will not be able to bind to the promoter region. b. Prokaryotic RNA…
1. Describe the cell cycle. Why do cells divide? Why are the resulting daughter cells from Mitosis genetically identical? How can abnormal (cancerous) growth cell growth be prevented?
1.Why is mitosis also referred to as the equational division? 2. Where does the spindle fibre originate from?
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
1. In animals, cytokinesis occurs in which of the following phases of mitosis? a. Telophase b. Interphase c. Anaphase d. Prophase 2. Which of the following best describes the function of telomerase? a. The telomerase uses its RNA component as a template and performs reverse transcription to extend the telomeres. b. The telomerase uses an external RNA transcript as a template and performs reverse transcription to extend the telomeres. c. The telomerase uses its RNA component as a template and recruits DNA polymerase I to extend the telomeres. d. The telomerase uses an external RNA transcript as a template and recruits DNA polymerase I to extend the telomeres. 3. Which of the following is not involved in the elongation of prokaryotic peptide? a. EE-Tus, EE-Ts, EF-G factors b. mRNA c. peptidyl transferase d. formyl met tRNA
1) The activity of the cell cycle is controlled by the abundance of: A) protein ligases and protein kinases B) protein kinases C) protein ligases D) protein kinases and cyclins E) cyclins Eukaryotes - prokaryotes? Which are the latter? A) bacteria B) animals C) tardigrades D) plants E) fungi During translation the ribosome: A) reads the DNA from 5' to 3' B) ribosomes are not involved in translation C) reads the RNA from 3' to 5' D) reads the DNA from 3' to 5' E) reads the RNA from 5' to 3'