Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally different mechanisms. Name and briefly describe these mechanisms.
Q: 4) Identify three positions of the patient to obtain a BP. 7) What problems can result from high…
A: Only three subparts can be answered per question as per Bartleby's policy and hence: - (i) Can…
Q: A ADF F D Match the structure given with the name. Acetyl coenzyme A pyruvate Complex V of the…
A: The given structures in the figure are the structures involved in cellular respiration for the…
Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…
A: Histones are proteins that package and protect DNA. They are subject to a variety of modifications,…
Q: Which group of echinoderms has a biradial symmetry and tube feet all over its body?
A: Tube feet is one of the small flexible tubular processes which present in most of the echinoderms…
Q: Question 30 Match the following methods of Analysis: ✓ Lipid anchor is myristic acid and linked to a…
A: Lipoproteins are complex lipids made up of cholesteryl ester and triacylglycerol that are encased in…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1- "Man is the only real enemy we have. Remove Man from the scene, and the root cause of hunger and…
A: Ecology is the science that deals with the distribution of a number of living species influenced by…
Q: A diploid cell has 6 chromosomes. How many chromosomes are present in this cell in Metaphase of…
A: Introduction There are two types of cell division are found in our body, i.e. mitosis and meiosis.…
Q: 3. Which side of the heart pumps oxygenated blood to the body a. Left side b. Right side
A: The heart is the organ which pumps the blood to the body. The heart is the link between the lungs…
Q: Question 1 Which of the following lipoproteins is primarily involved in reverse cholesterol…
A: Introduction Reverse cholesterol transport is define as a type of mechanism by which excess of…
Q: When a cell goes through Asexual reproduction, e.g. Mitosis, or fission, it creates: O Somatic Cells…
A: Asexual reproduction is a process where an organism creates a genetically identical copy of itself…
Q: 11. Tube the carries sperm from epididymis to urethra during ejaculation. 12. Thick whitish fluid…
A: (According to Bartleby guidelines, only the first three subparts have been answered. Kindly post the…
Q: Describe the mycobacterial cell wall and give one reason why it is important in the treatment of the…
A: Introduction:Tuberculosis (TB), which is caused by the intracellular bacteria Mycobacterium…
Q: Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology are…
A: Introduction Molecular biology:- It is the branch of biology that studies the molecular basis of…
Q: E. coli strains diploid for the lac region were constructed by introducing a plasmid carrying the…
A: ANSWER;- I- mutation- repressor is unable to bind to the operator region. If there is no other…
Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughters…
A: The cell division consists of two main steps the division of nucleus and the division of cytoplasm.…
Q: Question 3 "On average, how many amino acids engaged in predominantly hydrophobic alpha- helices…
A: Introduction:- The main chain of a polypeptide when folded in space adopts a conformation called…
Q: select a microbe that has proven to be either environmentally or socially beneficial to human…
A: In this question we have to describe about the useful bacteria . See full answer in step 2.
Q: Which will consume highest amount of 1₂ to become saturated? Which has the highest melting point?…
A: Saturated and Unsaturated fats Saturated fats are those that have single binds between their carbon…
Q: Question 34 Which characteristic is shared by a cell membrane and a chylomicron? Both contain…
A: Introduction:- All lipid molecules in cell membranes are amphipathic (or amphiphilic), meaning they…
Q: With respect to wobble hypothesis all of the following are correct except: An inosine nucleotide in…
A: Introduction According to the Wobble hypothesis only the first two bases of the codon pairs with the…
Q: When looking at a stained cell under a high power light microscope, can one distinguish between the…
A: Introduction Chromosomes are threadlike structures made up of protein and a single molecule of DNA…
Q: Predict the level of genetic activity of the lac operon as well as the status of the lac repressor…
A: There are two regulatory factors present in the lac operon of E.coli These are the repressor…
Q: Identify the INCORRECT match between a situation and whether it is a case of Biosafety, Biosecurity,…
A: Biosafety and biosecurity rules.
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Epiphytes: Epiphytes have adapted to grow without soil in the canopy layer in a tropical rainforest.…
A: Epiphytes are also known as "air plants" because they are not held on to the forest floor. They grow…
Q: Jessica was trying to solve a problem given to her in class. Help her figure out which produces more…
A: Excretion is defined as the removal of waste products outside the body. The excretion process is…
Q: 2. A well-trained athlete is running 5 km. What is the difference in glucose metabolism in the liver…
A:
Q: What kind of membrane protein is found entirely outside the bilayer on either the extracellular or…
A: Introduction Peripheral proteins are membrane proteins which attach only temporarily to the…
Q: Which of the following statements are characteristics of the aerobic respiration method of making…
A: Please follow step 2 for detailed explanation.
Q: How would the BP of an anxious patient visiting a doctor be different than if the patient is calm?…
A: Normal blood pressure for most adults is defined as a systolic pressure of less than 120 and a…
Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…
A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…
Q: Some invasive species carry pathogens or parasites with them. Scientists think this might be one…
A: The invasive species terms refer to those organisms which are introduced or are alien species. If…
Q: Lipid absorption involves hydrolysis of dietary fat in the lumen of the intestine followed by the…
A: Lipids are synthesised by the smooth endoplasmic reticulum. For absorption of dietary fats, lipids…
Q: You are being approached by a bear in the woods. Unlike what you may have heard, you do not want to…
A: Autonomous Nervous system The autonomous Nervous system is a division of the peripheral nervous…
Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…
A: The genetic material in most higher organisms is DNA or Deoxyribonucleic Acid. It is a double…
Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughter…
A: CYTOKINESIS: Cytokinesis is the process in cell division by which, the cytoplasm of a single…
Q: 2. How long would it take for a certain bacterial cell to increase from 1x10² to 1x10²7 when the…
A: Time taken by bacterial cell to increase its number when generation time is 25 min :-
Q: What is the purpose of photosynthesis? * O to convert sunlight into energy. O to convert ADP into…
A: Photosynthesis is the process in plants in which plants prepare food using carbon dioxide and water…
Q: efer to the table below: Saponification Number 179 260 193 185 lodine Number 102 10 111 79 Oil…
A: Introduction Iodine number defined as the number of grams of iodine that are consumed by 100 gram…
Q: 3) Describe the exact location you should place the blood pressure cuff.
A: Location of blood pressure puff.
Q: In a typical insect leg, what part may be composed of 2 to 5 segments? a. Femur b. Trochanter c.…
A: In insects, the legs are jointed and usually have six parts - coxa, trochanter, femur, tibia, tarsus…
Q: Choose the right combination of components required to set up a polymerase chain reaction from the…
A: Polymerase chain reaction is a method widely used to rapidly make millions to billions of copies of…
Q: "apoA, apo(a), apoB, apoC and apoE" "apoA, apoB, apoC, apo E, and apol" O "apoB, apoC, apoD, apoE…
A: apolipoproteins are the proteins that bind lipids. These lipids could be in the form of cholesterol…
Q: Biology 1. Which statement(s) is/are most correct concerning the history of epidemiology: a. The…
A: Epidemiology The study and analysis of the occurrence, trends, and causes of health and disease…
Q: Blank are chromosomes with the same genes but potentially different alleles while blank are exact…
A: Chromosomes are thread-like structures that become visible during the process of cell division.
Q: DNA replication involves a
A: DNA Replication: DNA is a self replicating material which carries the genetic information of the…
Q: There are several levels that describe biological organization. Tell me what these levels are and…
A: Cells are the basic building blocks of all creatures, albeit the quantity, shape, and types of cells…
Q: Question 1 Lipids from an organic sample are extracted separately using acetone (A), hexane (H), and…
A: The KHSO4 test is known as acrolein test and is used for fat or glycerol detection. Hexane extract…
Q: In an experiment, the bacteria were placed in dropper bottles containing glycerol as a carbon…
A: The purpose is to kill any previous bacteria on the loop before it is exposed to the bacteria. The…
Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally different mechanisms. Name and briefly describe these mechanisms.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The cholesterol synthesized by cells uses which component of the glycolytic pathway as a starting point? a. glucose b. acetyl CoA c. pyruvate d. carbon dioxideThe increase of ATP is due to what pathway in the catabolism of glucose?If the cell used one molecule of glucose and there was no loss of energy or intermediates what is the total number of moles of ATP generated per mole of glucose please explain
- Glucose is degraded into glucose and oxygen is released by respiration in Cows. From where, this glucose comes in Cows? Explain in detail each step of Glycolysis in your own words. Do not draw the Diagram. List enzymes and ATP used and synthesized. Where Glycolysis occurs in cells? write by keyboardExplain the role of enzymes within the cell and detail the specific enzyme activity of one of the following metabolic pathways (ATP → ADP, Pyruvate → Lactate or Glucose → Glucose-6-Phosphate).Assuming that all the glucose entering a muscle fiber is oxidized, as what molecule will the glucose carbon leave the body? Of glucose’s six carbons, two oxidized carbon byproducts will be produced by one enzyme, and four will be produced by a metabolic pathway. At which enzyme and pathway are these carbon-based bi-products produced?
- which of these events occur during the normal function of ATP in the cell?Outline the chemical reactions involved in the process of metabolism of one molecule of glucose until it is reduced to its by-products, carbon dioxide and water molecules, with ATP molecules produced in the process. Mention the specific locations in the cell where these chemical reactions involved in glucose metabolism take placeAt the end of glycolysis, but before the subsequent steps in cellular respiration, which molecules contain some of the energy held in the original glucose molecule?