Write a program with total change amount as an integer input, and output the change using the fewest coins, one coin type per line. The coin types are Dollars, Quarters, Dimes, Nickels, and Pennies. Use singular and plural coin names as appropriate, like 1 Penny vs. 2 Pennies. Ex: If the input is: 0 (or less than 0), the output is: No change Ex: If the input is: 45 the output is: 1 Quarter 2 Dimes Python for this please.

Write a program with total change amount as an integer input, and output the change using the fewest coins, one coin type per line. The coin types are Dollars, Quarters, Dimes, Nickels, and Pennies. Use singular and plural coin names as appropriate, like 1 Penny vs. 2 Pennies. Ex: If the input is: 0 (or less than 0), the output is: No change Ex: If the input is: 45 the output is: 1 Quarter 2 Dimes Python for this please.

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter3: Input/output

Section: Chapter Questions

Problem 12SA: 12. What is the output of the following program? (2, 3, 6, 8) #include <iostream> #include...

See similar textbooks

4.18 LAB: Exact change

Ex: If the input is:

(or less than 0), the output is:

No change

Ex: If the input is:

the output is:

1 Quarter 2 Dimes

Python for this please.

LAB
4.18.1: LAB: Exact change
4/ 10
АCTIVITY
main.py
Load default template...
1 ''' Type your code here. ''
2
Run your program as often as you'd like, before submitting for grading. Below, type any needed
input values in the first box, then click Run program and observe the program's output in the
Develop mode
Submit mode
second box.
Enter program input (optional)
45

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 4 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Complete and modify the code. 1 def to_share(total_candies, n_friends=4): 2 """Return the number of leftover candies that must be 3 smashed after distributing 4 the given number of candies evenly between 3 friends. 5 6 >>> to_share(91) 7 1 8 """ 9 return total_candies 10 11 to_share(10, 4) 12 to_share(5) 13 to_share(1, 5)
do some changes in code and make it unique #include <stdio.h>#include <stdlib.h>#include<string.h>//declaring functionsvoid firstFit(int [], int , int [],int );void bestFit(int [], int , int [],int );void worstFit(int [], int , int [],int );//starting programint main() {//declare partitions and processint partitions [] = {110, 450, 100, 250, 500};int processes [] = {212, 417, 112, 426};//getting their sizesint size_partitions = sizeof(partitions )/sizeof(partitions [0]);int size_processes = sizeof(processes )/sizeof(processes [0]);printf("Partitions size: ") ;for (int i=0; i<size_partitions; i++){printf("%d\t" ,partitions[i] );}//index partprintf("\nPartitions index: " );for (int i=0; i<size_partitions; i++){printf("%d\t" ,(i+1)) ;}printf( "\n" );// calling functionsfirstFit(partitions , size_partitions, processes , size_processes);bestFit(partitions , size_partitions, processes , size_processes);worstFit(partitions , size_partitions, processes ,…
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
1. Replace the (????) with relevant code to make th eprogram function. Details about the code are given below:(Java as been used) a) This program creates a reference to a file in main() and passes the reference to countWords() countWords(), not main(), reads the file and displays Total lines Total words Average words per line */ package finalexamtakehome1; import java.io.*; /** * * @author sweetkim */ public class Finalexamtakehome1 { //     public static void countWords(????) {     int lineCount = 0;     int wordCount = 0;         while (????()) {         String line = input.nextLine();         lineCount++;         Scanner lineScan = new Scanner(line);         while (????()) {             String next = lineScan.next();             wordCount++;         }     }         double averageWords = (double) wordCount / lineCount;     System.out.println("Total lines = " + lineCount);     System.out.println("Total words = " + wordCount);     System.out.printf("Average words per line =…
A .The following JavaScript command adds a method to a built-in class that can be called on any object instance of that class.Array.prototype.scramble = function() {   this.sort(function() {      return 0.5 – Math.random();   });} Select one: True False B. Suppose you have written a JavaScript for loop, and one of the statements that will execute with each iteration of the loop includes an anonymous function that uses the for loop’s counter variable, i. Which statement about this loop is true? a.The anonymous function will execute when it is called by the program, using the value ofiat the time it was encountered in the loop. b. The anonymous function will throw an error if it is called by the program after theforloop has finished iterating. c. The anonymous function will execute when it is called by the program, using the value ofiafter the final iteration of the loop. d.The forloop signals the JavaScript interpreter to copy the body of the anonymous function but not its…
4.10.1: LAB: Exception handling to detect input string vs. integer The given program reads a list of single-word first names and ages (ending with -1), and outputs that list with the age incremented. The program fails and throws an exception if the second input on a line is a string rather than an integer. At FIXME in the code, add try and except blocks to catch the ValueError exception and output 0 for the age. Ex: If the input is: Lee 18 Lua 21 Mary Beth 19 Stu 33 -1 then the output is: Lee 19 Lua 22 Mary 0 Stu 34 # Split input into 2 parts: name and ageparts = input().split()name = parts[0]while name != '-1': # FIXME: The following line will throw ValueError exception. # Insert try/except blocks to catch the exception. age = int(parts[1]) + 1 print('{} {}'.format(name, age))     # Get next line parts = input().split() name = parts[0]
Question 1 What will be displayed when the following code is executed?OOAAclass A:defBdefinit (self, i):15 6self i - iclass B(A):strreturn "A"(self):def main():def _init__(self, i, j):super().__init_(i)self.j = jb = B(5, 6)a = A (1)print (a)print (b)main() # Call the main functionNone of these answer choices is correct Full explainthe this question very fast solution sent me step by step Don't ignore any part all part work u Text typing work only not allow paper work
Review the following program: import urllib.request, urllib.parse, urllib.error fhand = urllib.request.urlopen('http://data.pr4e.org/romeo.txt') counts = dict() for line in fhand: words = line.decode().split() for word in words: counts[word] = counts.get(word, 0) + 1 print(counts) 3.1 Provide an explanation for EACH line of the following program. 3.2 Run the above program and include a full window screenshot with system time and date in the answer. 3.3 Run the above program with https://www.py4e.com/code3/romeo-full.txt and include a full window screenshot with system time and date in the answer.
5.12.2: Switch statement to convert letters to Greek letters. Write a switch statement that checks origLetter. If 'a' or 'A', print "Alpha". If 'b' or 'B', print "Beta". For any other character, print "Unknown". Use fall-through as appropriate. End with newline. import java.util.Scanner; public class ConvertToGreek {public static void main (String [] args) {Scanner scnr = new Scanner(System.in);char origLetter; origLetter = scnr.next().charAt(0); /* Your solution goes here */ }}
What will be the two lines displayed after executing the following code? def pair(e,f): ka=e-f api() return ka def api(): ka=4 print(ka) print(pair(934,91)) Separate your answers by a decimal point, eg, if the two lines are 17 and 15, then write 17.15
Suppose you have Java source files under the directorieschapter1, chapter2, . . . , chapter34. Write a program to remove the statement package chapteri; in the first line for each Java source file underthe directory chapteri. Suppose chapter1, chapter2,. . . , chapter34are under the root directory srcRootDirectory.The root directoryandchapteridirectory may contain other folders and files. Use the followingcommand to run the program:java Exercise12_20 srcRootDirectory
I'm having issues with my erase() function. What can I do to fix this? #include <iostream>#include <cassert>using namespace std; class SomeObj{public:SomeObj(int d ): id(d){}int getId() const;void output();private:int id;}; int SomeObj::getId() const{return id;} void SomeObj::output(){cout<<id<<endl;} template<typename T>class MyArray {public:MyArray();MyArray(int c);T& operator[](int index);void push_back(T e);int getSize() const;int getCapacity() const;int getIndex(T a);void erase(int index);private:void grow();T *data;int capacity;int size;}; template <typename T>MyArray<T>::MyArray(): capacity(15), size(0), data(nullptr) {} template <typename T>MyArray<T>::MyArray(int c):capacity(c), size(0) {assert(c>0);size = 0;capacity = c;data = new T[capacity];} template <typename T>T& MyArray<T>::operator[](int index) {if (index>size || index<0){cout<<"Illegal index"<<endl;exit (1);}assert(index…