Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'

Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2VQ

See similar textbooks

Related questions

Q: In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain…

A: Avery, McLeod and McCarty experiment was used to determine the genetic material and its nature on an…

Q: In a random sequence consisting of equal proportions of all four nucleotides, what is the average…

A: Restriction enzymes are natural occurring enzymes which are mainly found in prokaryotic organisms. A…

Q: From the following choices, select the DNA sequence that is classified as a mirror repeat. ATCATC O…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…

Q: natural selection, genetic drift, and gene flow.

A: Evolution:It is defined as the process of change in the inherited characteristics of biological…

Q: Sister chromatids normally separate during which of the following phases of division? a…

A: Just prior to mitosis, each chromosome duplicates to form sister chromatidsSister chromatids are…

Q: Give a full discerption of luminescence and fluorescence. Then in short sentence what is the…

A: Luminescence and fluorescence are phenomena that are related to the emission of light from certain…

Q: Write a summary for this article…

A: This article on climate change in the US was published nine years ago 2014.In this article, it…

Q: Eat eggs and exercise to live longer! ” Obviously, this ‘headline’ is fictitious, but it got your…

A: This article leaves many unanswered questions that hightlights further need of informations

Q: A cell that produces a lot of _________ would have a lot of ribosomes.

A: The number of ribosomes within a cell may vary depending on cellular requirements, growth…

Q: Imagine strong directional selection is applied, favoring large values of this trait. After one…

A: In the given scenario, we are presented with two graphs (A) representing the relationship between…

Q: Consider the expression of HOX genes in a wild type embryo. Predict the pattern of HOX gene…

A: In the study of HOX gene expression in embryos, it is important to consider the impact of specific…

Q: ATP is used by the cell to perform work. O True O False Question 91 lonic bonds in compounds are…

A: All living things depend on nucleic acids, proteins, lipids, and carbohydrates as the basic…

Q: What effect would a continuous supply of exogenous estrogen or progesterone have on an adult female…

A: Estrogen and progesterone are two hormones that play important roles in the female reproductive…

Q: Would one expect to see any cyanobacteria cells dividing by mitosis or meiosis? Why?

A: Cyanobacteria, also known as blue-green algae, are prokaryotic organisms that belong to the domain…

Q: The results of a test cross of a plant that is heterozygous for three traits encoded by the genes D,…

A: Physical mapping is used to find the order of genes and the distance between genes in the DNA…

Q: Which of the following parameters should be altered to increase the amount of vector-insert…

A: In molecular biology research, ligation is a fundamental technique used to join DNA fragments…

Q: 4- a) b) data How can bioinformatics tools be used to study posttranslational modifications? By…

A: The area of bioinformatics, which combines the study of biology, information technology, and…

Q: The sequence below is a template strand sequence for a gene (a very short one!). Identify the start…

A: The reading frame is determined by the start codon, which is typically AUG (encoding methionine) in…

Q: All of the following are characteristics of epithelial tissue EXCEPT: contains matrix avascularity…

A: It is composed of cells laid together in sheets with the cells tightly connected to one another.It…

Q: Draw an oxygen-hemoglobin dissociation curve. Put in the points that represent systemic venous and…

A: A graph that shows the connection between the partial pressure of oxygen (PO2) and the saturation of…

Q: outline the Danger, Response, Airway, Breathing and Circulation (DRABC) Model and make it relevant…

A: The DRABC model is a widely recognized framework used to assess and manage emergencies. When applied…

Q: 1st Bag: shredded wheat original cereal, Warm water, and yeast (no sugar) 2nd Bag: Cinamon Toast…

A: Fermentation is a fundamental biological process that has been harnessed by humans for centuries to…

Q: signal transduction pathway for auxin

A: This pathway refers to a series of molecular events which transmit a signal from the extracellular…

Q: Question 10 Which of the following membrane transport methods requires ATP molecules to work? A…

A: Membrane is the outer covering of cell. It acts as a barrier between extracellular and intracellular…

Q: What are the different Pre-zygotic and Post-Zygotic Reproductive Barriers?

A: Acvording to our guideline we can answer only the first question with three subparts. You hava…

Q: The following is a high-risk area. Discuss the opportunities for the risk management team to help…

A: Surgery and anesthesia. They can be unsafe since they're exceptionally complicated and the…

Q: A turkey farmer is worried about a new disease that is found in his birds. If affects females more…

A: It is given that A disease is found in turkeys Disease predominantly affects female turkeys than…

Q: I II III 2 1 2 3 3 5 2 6 7 What is the most probable genotypes of individuals 1-1? What is the most…

A: Pedigree charts are family trees that show the members of a family who have been affected by genetic…

Q: Define parsimony. How is it used to build phylogenetic trees?

A: The scientific study of phylogeny is known as phylogenetics.Phylogenetic tree is a branching…

Q: Activators bind to genes at enhancer sequences and increase transcription. ACTIVATORS ACTIVATOR…

A: In eukaryotes, transcription is a complicated process that is regulated by a number of variables to…

Q: In a lake, the _________ has the lowest temperature.

A: The hypolimnion is the deepest layer of water in a stratified lake located below the thermocline. In…

Q: Task #3: Design primers agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61…

A: In molecular biology and genetic research, the design of primers and the incorporation of…

Q: The nuclear envelope of a cell is a phospholipid, bi-layered structure surrounding eukaryotic…

A: Eukaryotes are organisms with a nucleus that is enclosed in a nuclear envelope. Other membrane-bound…

Q: bronchial tree

A: It is a complex network of organs, tissues and structures which are involved in the process of…

Q: If one side of the helix is CACTGGACTGTG, the complementary side would be??

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA is the genetic material…

Q: What a cell or tissue will normally develop into during development A. Cell Fate B. Competence C.…

A: Cells and tissues go through a number of complex processes during development that ultimately result…

Q: Canadian sources only (please no U.S. as regulations are different). Answer in your own words and…

A: Food spoilage refers to the process by which food becomes unfit for consumption due to various…

Q: Make a quick list of four dishes, of which one is made with vegetables that you had for your meal…

A: Salad (made with vegetables)Grilled chickenRice pilafGlass of red wine (alcohol after the…

Q: 7. What is the reflex? Give one example and explain how it helps protect your body

A: Reflexes are an important part of our life. These are actions that occur without putting any thought…

Q: Brief description of Keto Diet. Will this diet provide the body with all the micro and…

A: The Keto diet or the Ketogenic diet, is a high fat, adequate protein and low carbohydrate diet. This…

Q: Diversity: Who is/isn’t represented when we discuss chronic diseases, and what can we do about it?…

A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: R-S? E-P? E-S? L-B? X-L? R-X? P-B? X-B? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ]…

A: There are a following few important terms.Linked genes: When two or more genes reside on the same…

Q: Describe the issues associated with drug safety after FDA approval

A: FDA stands for food and drug administration, is a government agency, formed in 1906. This agency is…

Q: %OM pH EC Ca2+ Mg2+ K+ Na+ Al3+ H+ % dS/m cmolc/kg soil cmolc/kg soil cmolc/kg soil cmolc/kg soil…

A: In the field of soil science, understanding the quality and composition of soil is essential for…

Q: vestibule and of semicircular canals 6. What is adaptation? Give one example of body's capacity for…

A: Adaptation is a fundamental process through which organisms adjust and respond to changes in their…

Q: please list and explain some of the best ways to test for renal function?

A: A pair of kidney is present in our body. Kidney is one of the important organs of our body and it…

Q: Which of the following tools should be used in identifying a mutation in a sequence compared to a…

A: Gene mutations, and alterations in the DNA sequence, play a fundamental role in shaping life and…

Q: Producers or Primary Producers: Also called ________________, make their own food by extracting…

A: As per the guidelines of Bartleby,"Since you have posted multiple questions, we will provide the…

Q: you did a serial dilution experiment to determine the CFU/table of the Equate Children's…

A: The count for bacteria is done by counting the number of colonies on a culture plate when a known…

Q: Investigations of the microbiome have become an important part of research efforts in human health…

A: To investigate the relevance of the oral microbiome in tooth decay, the following approach can be…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Give only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Define dotplot algorithm

VIEW

Step 2: Python code

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In each case, if 1 µg of DNA was digested by these enzymes, calculate the number of ng of DNA present in each fragment (complete the table).
Match the shorter sequence relative to the longer one. Note: Observe Chargaff's rule of base pairing Longer sequence: T C A C G A T C A G C T C G A A G C A C Shorter sequence: T C G T G Clue: More than one correct answer
Considering the number of base pairs, compute for the actual length (in micrometers) of this DNA model
Give only typing answer with explanation and conclusion Recombinant human insulin produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns 1. Every cell in the human body has the same DNA, so very cell has an insulin gene. However in order to use the technique, you described in b, you would have to start with cells from the pancreas the only body cells that actually produce the insulin protein. Why are these the only cells that would work.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Give only typing answer with explanation and conclusion A circular double-stranded DNA molecule contains 4200 base pairs. In solution the molecule is in a B-form helix, with about 10.5 base pairs per turn. The DNA circle has 12 superhelical turns. Part A What is its superhelix density σ?
Give typing answer with explanation and conclusion What is the transcription product of the DNA templa GCTAGCGATGAC-5'? OA) CAGTAGCGATCG OB) CGAUCGCUACUG OC) CGATCGCTACUG OD) CGUTCGCUTCUG
Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA. pppApCpUpGpGpCpApA−OH
true or false: DnaB acts as a helicase and unwinds strands of DNA.
With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…
Only Handwritten answer needed Using multinominal coefficients: How many DNA strings of length 13 contains 4 As, 2 Cs, 3 Gs and 4 Ts and are palendromes?
Give only typing answer with explanation and conclusion Your analysis has identified that this new organism has same chromosomal structure as that of eukaryotes on earth. However, the average length of linker DNA of the new organism is 100 bp. If the haploid genome of the new organism has a size 6 billion bp, how many nucleosomes will be in this new organism?