You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein). You have just woken up to a transcription factor sitting down on your local TATA box. Tell me all your life events from beginning vou just saw the transcription factors) to end fyour protein death). Don't forget to mention WHERE you have lived during your life, how you have moved, what helped you along the way, and all the other proteins and other small molecules you have

You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein). You have just woken up to a transcription factor sitting down on your local TATA box. Tell me all your life events from beginning vou just saw the transcription factors) to end fyour protein death). Don't forget to mention WHERE you have lived during your life, how you have moved, what helped you along the way, and all the other proteins and other small molecules you have

Name: You are lovely little gene which makes the actin protein (the cytopla
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein).You have just woken up to a transcription factor sitting down on your local TATA box. Tell me allyour life events from beginning vou just saw the transcr

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 10RQ: Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional...

See similar textbooks

Similar questions

You head into a eukaryotic cell. Ms. Frizzle turns to you and says: "Gene expression is essential to keeping a cell alive. I want to see either transcription OR translation up close! Please pick one. Tell me where we should go to see it happening, and describe what we will see when we get there!"
Antibiotic-resistance is one of the gravest dangers to the world’s medical system. As a result, Dr. Jhon Peῆa decides to apply for a research grant from the NIH to investigate novel targets for antibiotic treatment in his lab. Most bacteria have developed resistance to counter the effects of the current crop of antibiotics, which largely target the cell wall, plasma membrane, or ribosomes. Dr. Peῆa’s team has instead been investigating bacterial transcriptional sites and all of his students are asked to attend a group Zoom meeting to discuss ideas to put into the grant. 1) Dr. Wilhem, his post-doc, mentions that heat-sensitive RNA pol mutants found in yeast might be worth exploring to see if they could be genetically engineered into E. coli. He reckons that anyone who is sick from a bacterial infection typically develops a fever so this would activate their destruction. a GREAT IDEA! b SUCKY IDEA! Yeast are eukaryotic so their RNA pol binds to a different site…
Antibiotic-resistance is one of the gravest dangers to the world’s medical system. As a result, Dr. Jhon Peῆa decides to apply for a research grant from the NIH to investigate novel targets for antibiotic treatment in his lab. Most bacteria have developed resistance to counter the effects of the current crop of antibiotics, which largely target the cell wall, plasma membrane, or ribosomes. Dr. Peῆa’s team has instead been investigating bacterial transcriptional sites and all of his students are asked to attend a group Zoom meeting to discuss ideas to put into the grant. 1) One of Dr. Peῆa’s doctoral students, Marisol, finds out there are multiple mutant forms of U ribozymes using BLAST. Remember that U ribozymes make up part of the spliceosome . Will this news be of any benefit? a YES! LOF in any of the U ribozymes will halt splicing, which is necessary before a transcript can be translated. b NO! Bacteria are capable of alternative splicing so they will use a…
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional level b. epigenetic and transcriptional levels c. epigenetic, transcriptional, and translational levels d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels
Effect of Paternal Grandmothers Food Supply on Infant Mortality Researchers are investigating long- reaching epigenetic effects of starvation, in part because historical data on periods of famine are widely available. Before the industrial revolution, a failed harvest in one autumn typically led to severe food shortages the following winter. A retrospective study has correlated female infant mortality at certain ages with the abundance of food during the paternal grandmothers childhood. FIGURE 10.12 shows some of the results of this study. FIGURE 10.12 Graph showing the relative risk of early death of a female child, correlated with the age at which her paternal grandmother experienced a winter with a food supply that was scarce (blue) or abundant (red) during childhood. The dotted line represents no difference in risk of morality. A value above the line means an increases risk; one below the line indicates a reduced risk. 3. There was no correlation between early death of a male child and eating habits of his paternal grandmother, hut there was a strong correlation with the eating habits of his paternal grandfather. What does this tell you about the probable location of epigenetic changes that gave rise to these data?
Effect of Paternal Grandmothers Food Supply on Infant Mortality Researchers are investigating long- reaching epigenetic effects of starvation, in part because historical data on periods of famine are widely available. Before the industrial revolution, a failed harvest in one autumn typically led to severe food shortages the following winter. A retrospective study has correlated female infant mortality at certain ages with the abundance of food during the paternal grandmothers childhood. FIGURE 10.12 shows some of the results of this study. FIGURE 10.12 Graph showing the relative risk of early death of a female child, correlated with the age at which her paternal grandmother experienced a winter with a food supply that was scarce (blue) or abundant (red) during childhood. The dotted line represents no difference in risk of morality. A value above the line means an increases risk; one below the line indicates a reduced risk. 1. Compare the mortality of girls whose paternal grandmothers ate well at age 2 with that of those who experienced famine at the same age. Which girl was more likely to die early? How much more likely was she to die?
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
Fill in the blanks Enzymes that catalyze RNA-directed DNA synthesis are called ______. A(n)__________ is an enzyme that cleaves DNA at specfic sequences. The large multisubunit complex that links the general transcription factors to the gene-specific transcription factors is called __________.
1) Antibiotic-resistance is one of the gravest dangers to the world’s medical system. As a result, Dr. Jhon Peῆa decides to apply for a research grant from the NIH to investigate novel targets for antibiotic treatment in his lab. Most bacteria have developed resistance to counter the effects of the current crop of antibiotics, which largely target the cell wall, plasma membrane, or ribosomes. Dr. Peῆa’s team has instead been investigating bacterial transcriptional sites and all of his students are asked to attend a group Zoom meeting to discuss ideas to put into the grant. The lab technician, Jazmin, wonders if anyone thought of blocking the entrance way to the ribosome, the translator of mRNA? What does the rest of the lab think? a Considering the grant is for transcriptional targets, this makes no sense. b This makes perfect sense since the bacterial ribosome has a different structure than the eukaryotic ribosome, which everyone learns in Intro Bio in their…
The assembly of transcription factors on a promoter begins some 25 nucleotides upstream where it binds to a start _______________ sequence Group of answer choices TAAT ATTA TATA ATGC
The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start site