You have evaluated the rate of aerobic degradation of organic matter in an industrial wastewater and found that it does not follow normal Monod kinetics. After some testing, you have found that the substrate degradation rate follows the following relationship instead: -rut = k0.5XaS0.5 where -rut = substrate utilization rate (mg/L•day) k = 4 (L/mg•d2) S = substrate concentration (mg/L) Xa = active microbial concentration (mg/L) You have also determined coefficients of bacterial growth on this substrate under aerobic conditions to be Y = 0.25 g VSSa/g substrate and b = 0.08/d. (VSSa, active volatile suspended solids) Estimate the effluent substrate concentration when treating the above wastewater in a CSTR (continuously stirred tank reactor) with recycle while operating at a θx (MCRT, mean cell residence time) of 4 day.

Q: The following is a type of endocytosis involving the cell drinking fluids: O a. Na-K-ATPase Protein…

A: Introduction :  The process of endocytosis is when the materials enter the cell. The process…

Q: Please define/describe the following 3 renal functions in mammals: filtration, reabsorption and…

A: Excretion The process of removal of waste products out of the body.

Q: Create a mind-map about the concepts you know, or understand about Dental Public Health.

A: Introduction   Individuals can benefit from dental care. A good root canal or filling can…

Q: What type of vertebra articulates to the top of the sacrum? Identify the set of tiny bones that…

A: The sacrum is a large bone located at the terminal part of the vertebral canal, where it forms the…

Q: How does the size of the human popula Contribute to environmental degradation? ton

A: In 1800, the Earth's population was around 1 billion, while only 2 centuries later, the global…

Q: CH₂OH OH OPO3-2 OH

A: Glucose is stored in the form of glycogen in the body. Glycogen is broken down to form…

Q: The graph below shows the species richness of a community undergoing secondary succession. The…

A: We will provide the answer for the 3rd question as all other answers are correct. Ecological…

Q: The following describes the concentration of particles in a heavily salted solution: O a Hypertonic…

A: Osmolarity is a process of measurement of solute concentration. It is the number of osmoles (Osm) of…

Q: What are some enviromental factors that would have contributed to the large amount of bacteria on my…

A: Bacteria are prokaryotes and fall under kingdom-Monera. Bacteria are cosmopolitan and thus, are…

Q: This cell is in what stage? Interphase Prophase Metaphase Anaphase Telophase

A: Genes that are sufficiently close together on a chromosome will tend to "stick together," and the…

Q: In detail explain how photosystems I and II capture light using different photosystems

A: Photosystems, which are large complexes of proteins and pigments (light-absorbing molecules) that…

Q: 1. Two molecules that can pass easily through the plasma membrane, between phospholipids, include…

A: Plasma membrane The membrane which is selectively permeable and allow only certain molecules to pass…

Q: If there is a tiny island in the ocean, that is located 3,000 kilometers away from any other island…

A: Islands are isolated land masses surrounded by water. They are found all throughout the planet, and…

Q: Young children have "more" bones than adults. What happens to those "extra" bones?

A: Introduction  Bones are composed of specialised bone cells and connective tissue that has been…

Q: 50. A healthy 54-year-old man who is participating in a study on renal function has been following a…

A: Sodium is needed for our body to maintain blood pressure, to conduct nerve impulses , in muscle…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: You have a cellulose sack that is impermeable (i.e. NOT permeable) to starch molecules and is filled…

A: Isotonic, hypertonic, & hypotonic are commonly used when a reference to the cell of a living…

Q: In genetic engineering, can we insert the gene from human to  E. coli (bacteria)? Explain your…

A: Genetic engineering involves modification of DNA in an organism that alter The characteristics of…

Q: The AG of the reaction C6H12O6 + 60₂ --> 6CO₂ + 6H₂O is -686 kcal/mol glucose oxidized. The AG of…

A: In order to understand the reaction, a few basic definitions are provided below - δG refers to Gibbs…

Q: Viruses are composed of which type of genetic material inside of a protein shell? a. Not all…

A: Introduction :- Large biomolecules and macromolecules known as proteins are made up of one or more…

Q: How does the eye normally adjust to looking at objects atd ifferent distances.?

A: Accommodation is a character of eyes where eyes can produce an image of an object on the retina by…

Q: EXPLAIN HOW MITOCHONDRIA PARTICIPATED IN CELL DEATH??

A: Apoptosis is interceded by proteolytic enzymes called caspases, which trigger cell death by cleaving…

Q: Can you explain both of your answer?

A: 1. The correct answer is option d) X-linked recessive  Although some female carriers of X-linked…

Q: The Michaelis Menten equation for enzyme kinetics can accurately predict when a single enzyme will…

A: Introduction Michaelis–Menten kinetics is a well-known paradigm of enzyme kinetics in biochemistry.…

Q: Which of these phylogenetic trees shows different relationships from the others? Tree 1) Tree 4) f…

A: Phylogenetic tree This is a branching diagram, that showing evolutionary relationships among…

Q: Kate and her husband are both heterozygous for galactosemia gene. If Kate and her husband have four…

A: A group of hereditary disease known as galctosemia which means galactose in blood. Undigested…

Q: 5:00 Which of the following is NOT found in the indicated region of a spermatozoon? S A) DNA C)…

A: We know that Sperm is the male gamete that is produced by spermatogenesis in the testes. They…

Q: What are the 5 spaces of the infrahyoid neck and the contents of each?

A: Introduction :- The visceral, anterior, posterior, carotid, retropharyngeal, and perivertebral…

Q: Glucose 2 ATP k. a. h. 2 ADP 2 PGAL electron transport r. +2e + 0₂ d. 2 NAD + b. 4 ADP C. 2 NAD + f.…

A:

Q: lease explain the reason   To make a new DNA strand, you need (check ALL that apply)...     a…

A: DNA Deoxyribonucleic acid is the genetic material present in almost all living organisms. The DNA…

Q: Which of the following requires a specific interaction with the molecules or substance it is going…

A: Introduction Endocytosis is a cellular mechanism that allows substances to enter the cell. A layer…

Q: 4) Differentiate between and describe the three types of phosphorylation as discussed in the lecture…

A: Phosphorylation is the process in which ADP reacts with inorganic phosphate to form ATP. This…

Q: When might genetically modified (GMO) plants be of benefit?

A: Genetically modified (GMO) plants are plants which have altered genetic material. The plants have…

Q: what changes have happened technologically, medically, Culturally and nutritionally that results in…

A: Introduction Human growth is determined by total birth, death, immigration, and emigration.…

Q: What is/are true statements about Action Potentials? Select all that apply. Group of answer choices:…

A: Introduction  When the membrane potential of a particular cell site rapidly increases and decreases,…

Q: If you worked for a pharmaceutical company and wanted to develop a vaccine to prevent viral…

A: Through TQM, both upper-level management and front-line workers are incentivized to focus on the…

Q: 11. A phage cross is made by doubly infecting the host bacterial cell with parental phages: m¹g¯ X…

A: The parental genotypes are produced without crossing over. The recombinant genotypes are produced as…

Q: Why is sensory adaptation advantageous?

A: Note: As per guidelines,we can answer one question at a time. Ask rest !!Introduction  In order to…

Q: Place the following steps of DNA replication in order: Origin melting RNA priming Helicase loading…

A: DNA replication is the process by which the genetic material of a cell is duplicated before the cell…

Q: Explain the role receptor-mediated endocytosis (RME) plays in virus replication (lytic cycle).

A: The plasma membrane is made up of phospholipids, proteins, and carbohydrates. Only some molecules…

Q: explain what your next steps are if your Free Water  test exceeds the allotted PPM

A: High TDS level in water not only deteriorate it's taste but also it's odour. If such water is…

Q: write summary on Marine biomes

A: Large biological zones that occur on the Earth's surface are known as biomes. They are, in reality,…

Q: The cell senses ATP is not being produced. What immediate effect will this have on the rate of…

A: INTRODUCTION ATP Adenosine triphosphate : source of energy.

Q: How this picture demonstrates people helping to maintain biodiversity?” What these people are doing?…

A: Aquatic biodiversity is crucial to sustaining and preserving the general health of the environment…

Q: methyl group Question #2 Copy the structures of the following amino acids from page 40 in your text:…

A: Amino acids are very important as they act as building blocks for the synthesis of proteins. They…

Q: Would water molecules move faster when there is a high concentartion gradient or low concentartion…

A: Introduction  The net movement of anything, typically from a place of higher concentration to a…

Q: What's the answer to question 1?

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: How can we organize circuits in the spinal cord to create rhythmic patterns?

A: Introduction The spinal cord, which connects the medulla oblongata in the brainstem to the lumbar…

Q: How many species are on the far small island? Rate of Change in the Number of Species over Time 00 O…

A:

Q: What technique would you use for each senario(a and b) and why. FISH, immunofluorescence, and GFP…

A: Introduction-FISH In this technique, the full set of chromosomes from an individual is affixed to a…