You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below.5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown regionAfter several tries, you obtained a beautiful sequencing image as shown here:The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C.Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CCThis website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet Question 1A. What is the primer sequence you designed? Please include the 5’ and 3’ ends. Question 1B. Why did you select the sequence as your primer? ddA ddC ddG ddT1.1}}}]”ו

A primer is a brief sequence of single-stranded DNA that is utilized in the PCR method of polymerase…

Answered: You were going to sequence a rice DNA…

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter5: Abbreviations And Systems Of Measurement

Section: Chapter Questions

Problem 7CRQ

See similar textbooks

Related questions

Concept explainers

Question

100%

You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below.

5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region

3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region

After several tries, you obtained a beautiful sequencing image as shown here:

The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline:

Tm is 55 – 60°C.

Ensures primer had a appropriate melting temperature for PCR ans sequencing.

The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%).
A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA.
The secondary structure of the primer must be none or weak.
No primer dimers (The primer anneals to itself).
3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC

This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet

Question 1A. What is the primer sequence you designed? Please include the 5’ and 3’ ends.

Question 1B. Why did you select the sequence as your primer?

Expert Solution

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 15 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.