Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients present.Make a schematic diagram to trace the flow of nutrients from the time of digestion to the time ofexcretion.
Q: Knowing that liquid liquid phase separation will occur when the change of gibbs free energy of the…
A: Inducing Liquid-Liquid Phase Separation (LLPS) in Cells-Liquid-liquid phase separation (LLPS) relies…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: C Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H…
A: Ans: D,EExplanation:Solution:The reactant molecule has two carbonyl groups and the conditions for…
Q: are best suited for diagnosing a disorder that is caused by low protein expression due to unwanted…
A: Molecular tests are best suited for diagnosing a disorder caused by low protein expression due to…
Q: What is the major organic product obtained from the following reaction? Ph 3 2 1. NaNH, 2. .Br Ph Ph…
A: Step 1:
Q: For protein expression, a different strain of Coli is being employed than the one used for plasmid…
A: Growth Media Preparation:When preparing the growth media, it's crucial to consider the nutritional…
Q: 80.00 mL of 0.350 M benzoic acid (K = 6.4×105) is titrated by 0.350 M NaOH. Calculate the pH of the…
A: Benzoic acid (C6H5COOH) is a weak acid with a dissociation constant (Ka) of 6.4 × 10-5. When it…
Q: enzymes do pol 6: Would replacing phosphate (PO4) with sulfate (SO4) in glycerophospholipid have any…
A: The question is asking about the potential effects of replacing the phosphate group (PO4) with a…
Q: The following data is for the oxidation of catechol (the substrate) to o-quinone by the enzyme…
A: Phenoloxidase is a key enzyme in melanization that catalyzes the oxidation of phenols.…
Q: What explains the very slow movement of membrane phospholipids from one leaflet of a biological…
A: The slow movement of membrane phospholipids from one leaflet of a biological membrane to the other…
Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: Suppose the concentration of glucose inside a cell is 0.4 mM and the cell is suspended in a glucose…
A: The following equation describes the mathematical relation for the change in free energy (ΔG)…
Q: No need to upload any image just give me the answer with explanation Explanation of the incorrect…
A: Fatty acid are the compounds containing a carbon chain with one end consist of carboxylic…
Q: An enzyme has a rate enhancement of 1.3x106. Calculate the value of ΔΔG‡ at 25.0 °C in kJ mol-1.…
A: Step 1: Step 2: Step 3: Step 4:
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Many heavy metals are toxic to humans. Certain proteins (like metallothionein) have the ability to…
Q: Deficiencies of carnitine, carnitine acyltransferases, or carnitine/acylcarnitine translocase affect…
A: CPT I deficiency is when long-chain fatty acids remain attached to carnitine in the matrix because…
Q: 200 ml of a 2% protein solution containing an enzyme that you want to purify. Half of the sample is…
A: In biochemistry and molecular science, enzyme purification is an essential process that isolates…
Q: Phospholipid lateral motion in membranes is characterized by a diffusion coefficient of about 1 x…
A: The objective of the question is to calculate the distance traveled by a phospholipid in a bilayer…
Q: Corona virus tes with a 5% false positive rate and a Corona virus infection rate of 5% in Canada, if…
A: The objective of the question is to calculate the probability that a person who tests positive for…
Q: Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients…
A: The objective of the question is to identify the nutrients present in a meal consisting of rice,…
Q: Consider the production of lauric acid (12:0) in the fruit of a coconut tree. The source of the…
A: (a) Lauric acid has twelve carbons in its structure. There are six carbons in glucose, which is a…
Q: 4. RNA hydrolysis As discussed in class, we can predict how much of RNA we expect to be in a…
A: RNA can undergo slow, nonenzymatic, spontaneous hydrolysis, due to the presence of 2'OH in its…
Q: 3. Following are the melting points of 18-carbon fatty acid Stearic acid Oleic acid Linoleic acid 70…
A: The question is asking to determine the number of simple and mixed triacylglycerols that can be…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, B-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: 2. The precise biochemical mechanisms underlying the rapid shutdown of glycolysis in skeletal muscle…
A: Detailed explanation:In anaerobic conditions, pyruvate is often converted into lactate or ethanol,…
Q: STEM Workplace Practices Q4
A: The objective of this question is to understand the difference between a product contaminant and a…
Q: A particular enzyme-catalyzed reaction has an apparent Vmax = 9.00 nmol s-1 and α' = 3.00 when 2.00…
A: Approach to solving the question: Detailed explanation:To calculate the Vmax for the uninhibited…
Q: What is the concentration in ppm of Sulphur in a water supply if there are 0.002mL of Sulphur in…
A: Step 1:We need to use the conversion 1ppm= 0.001mL/LBased on the given,Since we have 0.002mL/L…
Q: Why do animal cells store carbohydrate in the form of glycogen instead of glucose? (1 sentence)
A: The objective of the question is to understand why animal cells prefer to store carbohydrates in the…
Q: A gene encoding a miRNA was mutated so that it forms a perfect complement to its target mRNA. This…
A: MicroRNAs (miRNAs) are a class of small, non-coding RNAs that play a pivotal role in the regulation…
Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…
A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…
Q: O 2 ← 3 - Which diene can be used to prepare the following product by alkene metathesis? ہو ہو
A: To find the correct diene for the product, we need to consider the structure of the product and work…
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) Why would a defect in the liver enzyme…
A: In mammals, fructose-1,6-bisphosphatase (Fbp) has two isotypes: liver and muscle, which are encoded…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: Model 2: Reactions of carboxylic acids and esters (3) (4) + H₂O OH (5) OH (6) 'OR' OR' + H3O® + NaOH…
A: Answer (5) Reaction number 4 in model 2 is acid base reaction Explanation:Step 1: Step 2:Step 3:…
Q: While fatty acids longer than 20 carbons are rarely found in foods, lignoceric acid (24:0) is found…
A: Liganoceric acid (24:0) metabolism entails a number of crucial processes that lead to the production…
Q: what are three main categories of membrane proteins, and how are they distinguished experimentally?
A: The objective of this question is to identify the three main categories of membrane proteins and…
Q: 1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA…
A: The answers are:(a) Template Strand:3' - G T A T A T C A G T T A G A G C T A A T C - 5' Non-template…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…
A: Salt bridge is a bond between amino acids which carry opposite charges. The opposite charges exert…
Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…
A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…
Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…
A: The objective of the question is to understand the impact of obesity on the elimination half-life of…
Q: With regards to antibodies define the following terms in the space belowa. CDRsb. Constant regions
A: a. CDRs (Complementarity-Determining Regions):CDRs are specific regions within the variable domains…
Q: draw the mechanism for the glyoxalate cycle enzyme malate synthase typed solution
A: The glyoxyate cycle is an alternative pathway that allows the organism to convert acetyl CoA to…
Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: For the following results of Thermodynamics of Borax Solubility, the volume of Borax solution…
A:
Q: Draw the structure of cholesterol and write the biosynthetic relations of steroid hormones starting…
A: Cholesterol, a 27-carbon molecule, is the most common steroid in the body and plays a crucial role…
Q: The image uploaded answer is not allowed please
A: Glycolysis vs. Glycogenolysis:• Glycolysis: This is a metabolic pathway that breaks down glucose (a…
Q: 4. (4 pts) a) Describe one way in which Rubisco could be improved to optimize photosynthetic…
A: Rubisco, or Ribulose-1,5-bisphosphate carboxylase/oxygenase, is the most abundant protein in the…
Q: Number of reactions/steps that are highly regulated during glycolysis is/are __ ☐ 3 ☐ 10 ○ 1 4
A: Multiple steps in glycolysis are highly regulated to ensure the efficient control of the pathway.…
Q: TABLE 3-LACTATE PRODUCTION IN FORTIFIED HEMOLYSATES OF HUMAN ERYTHROCYTES* Substrate Glucose Glucose…
A: Detailed explanation: b): In mature erythrocytes (red blood cells), the end product of glycolysis is…
Your lunch meal contains rice, fish, vegetables and water for drinks.
Identify the nutrients present.
Make a schematic diagram to trace the flow of nutrients from the time of digestion to the time of
excretion.
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- In the following table, list all of the organs/structures in which the Process occurs: Process List ALL -when applicable- the organs where this process happens Ingestion Mechanical Digestion Chemical Digestion Motility: Peristalsis Motility: Segmentation Secretion Absorption Reabsorption and Compaction Defecationcreate a flow chart or diagram to illustrate the digestion and absorption of proteins. What will happen to the meat once we ingest them? Include the following from your flow chart or diagram: 1) the location or site where the digestion or absorption occurs 2) the enzymes 3) the products generated at each site or locationYou will only describe how proteins, carbohydrates, and lipids are digested in the body. The goal is to get to a point where there are only amino acids(from proteins), fatty acids (from lipids), and glucose (from starch). Enzymes are only part of chemical digestion. Provide a simple description of Ingestion, Movement, Mechanical digestions, absorption, and elimination related to your food. Lastly describe what glucose, amino acids, and fatty acids will be used once they are absorbed into the bloodstream.
- What is "digestion"? In what ways can analytical precipitate? digestion improve the quality of ancreate a flow chart or diagram to illustrate the digestion and absorption of carbohydrates. The starting carbohydrate molecules are starch, sucrose, lactose, glycogen, and cellulose. What will happen to these carbohydrates once we ingest them? Include the following from your flow chart or diagram: 1) the location or site where the digestion or absorption occurs 2) the enzymes 3) the products generated at each site or locationDescribe what happens to the food types specified below as they pass through the following zones of the Digestive system Mouth, Stomach, Small intestines, large Intestines. Specify the food example (Carbo-rich food)rice, (protein rich) chicken adobo, (fat rich food) crispy pata, Identify the enzyme that catalyzed the digestion process and the source enclosed in parenthesis. 1 Carbohydrate-rich food 2. Protein-rich food 3. Fat/lipid-rich food
- Digestion trails is one of the measurements of feed and nutrients utilization. Discuss how this trail is conducted.Digestion trails is one of the measurements of feed and nutrient utilization. Discuss how this trail is conductedWith the two menus provided, answer the question below: Menu 1: Roasted chicken with mashed potatoes (mostly proteins and carbohydrates) Menu 2: Pasta with alfredo saude and cheese (mostly carbohydrates, dairy products and lipids) Question: Clearly indicate where/when nutrient absorption takes place in the digestive tract
- Make a flow chart of Protein Digestion, Absorption and Nitrogen Excretion. Indicate the organs, enzymes and how it functions.There are several processes that take place from the moment food enters our mouth until it is completely digested and used for energy. Using approximately 400-500 words, describe in detail and in order of process the mechanical (stomach and intestine)and chemical (gastric acid and enzymes) digestion of eating a grilled chicken sandwich with mayonnaise, lettuce, and tomatoes. Note what role the pancreas, gallbladder, and liver play in digestion of the ingredients? From what ingredients is your body deriving its energy and how many basic calories from the macronutrients ingested? Include at least two scholarly references (using APA formatting and style) to guide your answers (note that you can use your textbook as one of your references).Define the following processes happening in the digestive system: Ingestion Mechanical Digestion Chemical Digestion Motility: Peristalsis Motility: Segmentation Secretion Absorption Reabsorption (and Compaction) Defecation
![Human Physiology: From Cells to Systems (MindTap …](https://www.bartleby.com/isbn_cover_images/9781285866932/9781285866932_smallCoverImage.gif)
![Human Physiology: From Cells to Systems (MindTap …](https://www.bartleby.com/isbn_cover_images/9781285866932/9781285866932_smallCoverImage.gif)