Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients present. Make a schematic diagram to trace the flow of nutrients from the time of digestion to the time of excretion.
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH RUES…
A: Data Points and PlottingThe graph I created is a scatter plot that displays values from two…
Q: Consider a cell that requires much more ribose5-phosphate than NADPH. The cell needs ribose…
A: The question is asking about the metabolic fate of glucose 6-phosphate, glycolytic intermediates,…
Q: 2. Shown below is a dipeptide. HN- HO. OH a. Over which pH range will the dipeptide predominantly…
A: An amino acid is a biomolecule with a hydrogen atom, an amino group, a carboxyl group and a…
Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…
A: The active sites can also refer to enzymes, so in this question we are talking about the enzymes…
Q: Which of the following hydrogens is most acidic? a A b B с C 11 1 CH₂ A с
A: Answer: b. BExplanation:On removal of the B proton, a carbanion(conjugate base) will form. Higher…
Q: 12. What is the major organic product obtained from the following reaction? OCH 3 Br2 CH3CO₂H Br 1 2…
A: This is reaction undergo electrophilic aromatic substitution. Electrophilic aromatic substitution is…
Q: The student advises using the same selection procedures and inoculating a 5 mL overnight culture…
A: Quantification: The process of plating on agar plates enables the counting of individual colonies,…
Q: Only 500% sure experts solve it correct
A: Peptides and Amino AcidsAmino acid monomers are joined into small chains called peptides by peptide…
Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…
A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…
Q: A particular reaction has a ΔG‡ of 37.0 kJ mol-1. In the presence of an enzyme, the same reaction…
A: The objective of this question is to calculate the change in Gibbs free energy of activation (ΔΔG‡)…
Q: Can H₂N-(AA)₂-Cys-(AA)-Lys-(AA)-Cys-(AA)-COOH HOOCCH₂S give by simple oxidation SCH2COOH…
A: The particular reaction in question, involving the formation of SCH2COOH, appears to be chemically…
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Here is a sample illustration of the described pathway above: To summarize, after glycolysis,…
Q: What explains the very slow movement of membrane phospholipids from one leaflet of a biological…
A: The slow movement of membrane phospholipids from one leaflet of a biological membrane to the other…
Q: Session 21180406 matching question Identify the type of lipid based on the structural features. 1st…
A: Lipids are a chemically diverse group of biomolecules that have two things in common:low solubility…
Q: Write a mechanism describing the conversion of citrate to acetyl CoA and oxaloacetate, catalyzed by…
A: ATP-citrate lyase (ACL) catalyzes the cleavage of citrate using energy from ATP to produce…
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) Why would a defect in the liver enzyme…
A: In mammals, fructose-1,6-bisphosphatase (Fbp) has two isotypes: liver and muscle, which are encoded…
Q: Import of fatty acids is used for which of the following? (check all that apply) Group of answer…
A: ANSWER WELL EXPLAINED ABOVE
Q: C Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H…
A: Ans: D,EExplanation:Solution:The reactant molecule has two carbonyl groups and the conditions for…
Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…
A: The objective of the question is to understand the impact of obesity on the elimination half-life of…
Q: Draw the major organic product obtained form the following sequence of reactions (assume that…
A:
Q: To prepare a gel sample, you want to load 50 ng total of protein/well. You have added 200 μL of…
A: Below answer given Explanation:Step 1: Step 2: Step 3: Step 4:Step 5:
Q: pless dont proved hand ratting solution
A: Step 1:The compound is written in Newman Projection. The circle indicates that it is projected in…
Q: Please write out the answer.
A: 1) The pathway diagram shows that for the conversion of valine to glucose via gluconeogenesis, 2…
Q: 2. Compare and contrast the biological roles of the following amino acids the following pairs of…
A: The objective of this question is to compare and contrast the biological roles of three pairs of…
Q: Compare and contrast mitosis and meiosis by filling up the table below
A: Cell division involves mitosis and meiosis, which are two distinct processes. Despite sharing some…
Q: (Biochemistry Topic: Electron Transport) Hypotheically, there is an animal which has the reductant…
A: 1. **Pyruvate Oxidation**: In aerobic respiration, the end product of glycolysis, pyruvate, enters…
Q: In three sentences describe how Sanger sequencing works
A: Copying DNA: To determine the sequence of DNA, scientists start by making many copies of the DNA…
Q: (c) (1 ) Fluoroacetate, prepared commercially for rodent control, is also produced by a South Afri-…
A: Let's go ahead and go further into each individual facet, shall we?1. Interrupt the citric acid…
Q: 8 From the Hill Plot below, the of the first binding event for the receptor-ligand system under…
A: The hill plot is a graph drawn based on the Hill equation given below.This identifies with the…
Q: Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl)…
A: The conversion factor depends on the type of RNA being quantified.Conversion factors for different…
Q: Can you help with q3 please, thank you.
A: The intermolecular interactions for the given active site of RNA is listed below . Explanation:Step…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…
A: Salt bridge is a bond between amino acids which carry opposite charges. The opposite charges exert…
Q: Why is 1, 2, 3, 4-tetraphenylcylopentadienone a dark purple color while most other organic compounds…
A: Option a: This option is incorrect because, 1, 2, 3, 4 - tetraphenylcylopentadienone is not a…
Q: Draw the major organic product obtained from the following sequence of reactions (assume that…
A: Approach to solving the question: Detailed explanation:in this reaction first process was nitration,…
Q: Suppose that we sample a signal at fS = 250 Hz and get alternating values of -2 and 6 V. (a) What do…
A: here we will be using Nyquist-Shannon sampling theorem ,The theorem states that to accurately…
Q: 0.25 Short answer questions, write answers on blank paper. A plot of enzyme activity with and…
A: LB plot is a double reciprocal plot which is constructed by taking inverse values of substrate…
Q: 2. The mature form of TEM-1 ß-lactamase, an enzyme of 290 amino acid residues that hydrolyzes…
A: Before calculating the isoelectric point (pI) of the enzyme, we need to be thorough with the…
Q: 9. Consider a phospholipid vesicle containing 25 mM Na+ ions. The vesicle is bathed in a solution…
A: The objective of the question is to calculate the electrochemical potential for Na+ ions at 25 °C in…
Q: 4. (4 pts) a) Describe one way in which Rubisco could be improved to optimize photosynthetic…
A: Rubisco, or Ribulose-1,5-bisphosphate carboxylase/oxygenase, is the most abundant protein in the…
Q: Modify the structure to show the MAJOR product that would be formed in the following reaction. HNO3,…
A: The process is electrophilic substitution.The Modified structure of the prouct is shown in the…
Q: Knowing that liquid liquid phase separation will occur when the change of gibbs free energy of the…
A: Inducing Liquid-Liquid Phase Separation (LLPS) in Cells-Liquid-liquid phase separation (LLPS) relies…
Q: Another member of your research group studied the kinetics of theGAPDH from the organism. They also…
A: Approach to solving the question: Detailed explanation: Examples: Key references:…
Q: STEM Workplace Practices Q2
A: The objective of the question is to understand the role of stability testing in ensuring the quality…
Q: MATCH a structure or term from the following list with each description below. Place the letter of…
A: 1. The reactive electrophile in Friedel-Crafts acylation reactions (R3C⁺): In Friedel-Crafts…
Q: Draw the major product of the following reaction. Br (CH3)3N Ag₂O, H₂O heat
A: Step 1:Given 2-butylbromide and reagent 1.(CH3)3N,Ag2O,H2O,3.heat Draw the products. Step…
Q: Which of the following processes is dependent on the activity of pentose phosphate shunt?…
A: The pentose phosphate pathway, or the pentose phosphate shunt, plays a crucial role in several…
Q: why do so many pharmaceutical drugs contain nitrogen? How would an NH2 group benefit this dimer…
A: The objective of the question is to find the reason why so many pharmaceutical drugs contain…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…
A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients present. Make a schematic diagram to trace the flow of nutrients from the time of digestion to the time of excretion.
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- In general terms, explain the role in insects of the malpighian tubules and rectum in conserving water, ions, and amino acids and removing nitrogen waste.Name the functions, food sources, and deficiency and toxicity symptoms for your selected nutrient: SodiumUsing the following information, work out the total calorie content: Carbohydrates 30g of which sugars 0g Fibre 12g Protein 15g Please answer asap and type your answer and do not copy from anywhere please
- A bull devours 5 kg DM of feed containing 60 g N/kg. The bull discharges 100 g N in the dung and 35 g N in the pee. The faecal and urinary N had 10 g metabolic faecal nitrogen (MFN) and 3 g endogenous urinary nitrogen (EUN) separately. Ascertain the BV of the protein in the eating routine.Visit your favorite quick service restaurant or visit the restaurant's website and select a typical lunch or dinner. This meal MUST include an entree, side dish, and beverage.Ask for the nutrition information or visit their website (your text book data base also has this information) and list the following information for your meal: total kcalories; fat kcalories; saturated fat kcalories; and sodium content. Post your meal items with sodium content of each food on the discussion board. List the total sodium content of the meal. Write a paragraph on the nutritional aspects, especially sodium, of your meal. Do you feel this is a good meal choice?Approximately 9,000 ml of water enters the digestive tract daily. How much of that water is absorbed? Question 48 options: 1,000 ml 3,000 ml 4,500 ml 7,500 ml 8,900 ml
- Nutrients diffuse out of the and wastes diffuse out of the The statement above is best completed by the answers in row: Row ii ロ tissues and into the capillaries tissues and into the capillaries capillaries and into the tissues capillaries and into the tissues tissues and into the capillaries capillaries and into the tissues capillaries and into the tissues tissues and into the capillariesWithin a few days after a fast begins, nitrogen excretion accelerates to a higher-than-normal level. After a few weeks, the rate of nitrogen excretion falls to a lower level and continues at this low rate. However, after the fat stores have been depleted, nitrogen excretion rises to a high level. (a) What events trigger the initial surge of nitrogen excretion? (b) Why does nitrogen excretion fall after several weeks of fasting? (c) Explain the increase in nitrogen excretion when the lipid stores have been depletedAnswer these questions related to feeds and animal nutrition: a.What are the advantages of using extrusion versus pelleting? b.Explain two factors that affect the utilization of minerals.
- Read each statement carefully and determine if it is true or false. Correct any false statement. T F Regulation of water balance occurs in the large intestine because its lining absorbs water.State and recognize the three basic nutritional needs an organism’s diet must satisfy. List the basic stages of nutrition. Predict how perturbations in the hormones leptin and ghrelin influence appetite. Use the concept of pressure to describe the movement of water and nutrients in plant xylem and phloem and blood in vertebrates. Trace the flow of a drop of blood through the four chambers of the heart, the great vessels, lungs, and the blood vessels (arteries, veins, and capillaries) in the systemic circulation in healthy people and people with various malformations of the heart or great vessels. Distinguish between systolic and diastolic blood pressure. Predict how perturbations in body posture or baroreceptors would affect homeostatic control of blood pressure.An adult male was diagnosed with atherosclerosis, the rate at which his cells take up LDL was measured and compared to the normal rate, and the results were plotted on a graph. Explain why the normal rate of LDL uptake levels off at high LDL concentration. Give a possible reason why the rate of LDL uptake of the patient is lower than normal and explain your answer. Helping tags: Biology, nursing, cell biology, medicine
![Nutrition Through The Life Cycle](https://www.bartleby.com/isbn_cover_images/9781337919333/9781337919333_smallCoverImage.jpg)
![Nutrition Through The Life Cycle](https://www.bartleby.com/isbn_cover_images/9781337919333/9781337919333_smallCoverImage.jpg)