1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50

1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter15: Biotechnology

Section: Chapter Questions

Problem 2CT: The results of a paternity test are shown in the table below. Numbers indicate the number of short...

See similar textbooks

Similar questions

If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
. Use the following sequence data to assign haplotypes and build a haplotype network for a 200 bp variable region that is sequenced from eight individuals. Polymorphic nucleotide positions are shown. Δ is a 1 bp deletion. Explain the logic supporting the network. If there are different nucleotide changes at one position, indicate the different changes on your network. Individual 24 56 92 119 146 172 haplotype 1 A C A T G G A 2 T C Δ C G G 3 A G A T A T 4 A G A T G T 5 A C Δ C G G 6 A G A T G G 7 A G A T A T 8 C C Δ C G G
A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
In Figure , what do the red and blue parts of the DNA labeled by balloon 6 represent?
Can you further explain the second primer how we get that and possibly draw it out? GTCAAATTACATTACACATAA
The region of the normal hemoglobin gene used for genetic testing for sickle cell anemia contains a restriction site such that homozygous normal individuals show two DNA fragments. If a single nucleotide change in hemoglobin destroys that restriction site, then how many DNA fragments will be visible on a gel from individuals that are homozygous mutant? What about heterozygotes?
What are the benefits of using a mixture classification scheme as outlined in DNA Box 14.1? What would be the advantages of using software for deciphering mixture components?
You learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…
In DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Notice that, for the Vicia species, the rate of renaturation is much faster in the first hour and then slows down. What might cause this initial rapid renaturation and the subsequent slowdown?
Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant ....CTTGCTAGCGAATC....