1. For each of the sequences given below, list what type of secondary structural element, if any is most likely to be formed by that amino acid sequence. 1a. SEGEWQLVLHVWA 1b. GKGPPGPPGPRGPC 1c. CHSRHPGDFSC 1d. ASVRMNLGF
Q: A trisaccharide was isolated from a new species of red algae. The sample was hydrolyzed and monosac...
A: Saccharides are the sugar molecule, which forms glycosidic bonds to give disaccharide or or tri or t...
Q: . Potassium: Insulin Overdose, Magnesium: Antacids a. both decreased b. both increased c. firs...
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any sp...
Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with trypsi...
A: Polypeptides are polymers of amino acids. These are made up of different amino acids.
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its ca...
A: Glucose is metabolized through the glycolytic pathway to yield energy in the form of ATP and NADH. P...
Q: Myoglobin and hemoglobin differ in...
A: Both hemoglobin and myoglobin contain a prosthetic group that is called heme protein that act as oxy...
Q: 25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. D...
A: A codon is a trinucleotide sequence of nucleic acid that corresponds to a specific amino acid. The g...
Q: The membrane phospholipids phosphatidyl serine and phosphatidyl choline are named based on ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Cells copy DNA to make RNA to make proteins. RNA is the messenger. Why use RNA at all? Why not make ...
A: The process of formation of RNA from DNA is known as transcription. And the process of making protei...
Q: sketch a graph with appropriate axis titles that demonstrate the connections between enzymes and act...
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that ...
Q: How do other biological organisms process sugars? Do they use glycolysis, or if not how do they proc...
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: You become worried that the flasks would burst open to the build up in gas pressure. What other mole...
A: When glucose is metabolized through glycolysis, there occurs the formation of pyruvate which is conv...
Q: A poultry farmer is curious about the effectiveness of two types of exogenous enzymes, namely papain...
A: Proteolytic enzymes are useful as a supplement to thr diet of ducks and turkeys as well as chickens....
Q: Which of the following molecules is richest in energy when metabolized? O Linolenate, a fatty acid ...
A: Glucose is the primary source of energy for the body. When there is no glucose available, the body d...
Q: DNA repair systems are responsible for maintaining genomic fidelity in normal cells despite the high...
A: Living organisms are constantly exposed to a variety of DNA-damaging substances that can have an imp...
Q: electron transport chain, yet somehow iron is utilized as an electron carrier multiple times. Choose...
A: Electron transport When the electrons pass into the electron transport chain through reoxidation of ...
Q: DNAs are an organism’s blueprint. The code for any trait/character is stored in it. What allows it...
A: The central dogma of molecular biology illustrates the process of the flow of genetic information, f...
Q: a. Provide the a–c cell projection for the space group, b. including a motif Provide all of the gene...
A: In mathematics, physics and chemistry, a space group is the symmetry group of an object in space, us...
Q: Calculate the amount of each solution needed to make 750 mL if a dextrose 25% solution given bony a ...
A: 25 % dextrose solution of 750 ml is to be prepared from dextrose 60% solution and dextrose 5% soluti...
Q: Is this the correct answer of R and T in the blanks or are they switched?
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These twen...
Q: Which protein is the key to the repeated formation of plaques ?
A: Plaque - Sticky and caused by the gradual buildup of a specific protein fragment.
Q: essential fatty acids
A: Essential fatty acids are essential unsaturated fats that are necessary for human health but our bod...
Q: 1. when ADH level is excessive, the plasma concentration of sodium is __ while water retention is __...
A: ADH: It is a hormone that controls the reabsorption of water molecules in the collecting tubules of ...
Q: What is glycemic index (GI)? Which food in the Philippine market has significant GI and list them wi...
A: GI is also known as Glycemic Index
Q: 1a)What is the purpose of adding 10mM of Tris-HCL (pH 7.5) during the extraction process? Oa....
A: Tris-HCl is an acidic buffer that is commonly used in research labs to resist changes or neutralize ...
Q: Is the following reaction an example of dehydration synthesis and hydrolysis? Explain your answer. C...
A: The given molecule is a disaccharide that is broken down into two molecules of monosaccharides. Mono...
Q: a) What was the full peptide sequence before degradation? b) Paula thought she forgot to treat her p...
A: Edmans degradation is a method of sequencing the amino acids in the peptide. In this first step meth...
Q: Which of the following is the correct glycosidic bond linkage of the disaccharide shown? OH HO но Он...
A: Glycosidic linkage is formed between sugar molecules. The monosaccharide units are joined together t...
Q: CHOH CHOH A CHOH CHOH 1 CH2 CHOH OH CH OH 3 CH.OH он CH CH OH B 2 CH If this were a portion of a pol...
A: A molecule synthesized by living organisms or cells is referred to as a "biomolecule." Carbohydrates...
Q: What is the glycosidic linkage between monosaccharide I and II? α-(1→2) β-(1→2) β-...
A: Glycosidic linkage: Glycosidic bonds formed between monosaccharide units are the basis for the produ...
Q: For the free fatty acid samples, lipase had been added to corn oil and samples taken over time as th...
A: Lipids are organic molecules that are soluble in organic solvents such as ether and chloroform but i...
Q: Which of the following is not true regarding bimolecular reactions? O Kassoc is the inverse of Kdiss...
A: “Question 8 has been answered as requested.” A collision between two reactants initiates the bimolec...
Q: Explain with an example the statement: Enzymes enhance reactions but are not consumed in the reacti...
A: Enzymes enhance reaction rate but are not consumed in the reaction
Q: A corn geneticist wants to obtain a corn plant that hasthe three dominant phenotypes: anthocyanin (A...
A: Cross over: It is important for the normal segregation of chromosomes during meiosis and to produce...
Q: Choose one example of a carbohydrates with a chiral carbon and draw its Fisher's and Haworth's struc...
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the ...
Q: Per NADH consumed by Complex I, indicate the number for each, AS those reducing equivalents flow thr...
A: The electron transport chain is a series of electron carriers through which the electrons are carrie...
Q: Why are buffers important in living systems?
A: Many biochemical processes require the maintenance of pH within a narrow range for proceeding at the...
Q: 2) oxaloacetate (OAA) occurs as an important intermediate in 2 metabolic processes a) indicate these...
A: "Since you have posted multiple questions we will answer the first question for you. If you want the...
Q: . which of the following will cause validation and make sure that the blood pressure will go back to...
A: Answer 3: c . Aldosterone Aldosterone causes an increase in salt and water reabsorption into the bl...
Q: simple explanation about proteins and its important part.
A: Proteins are one of the most important components of body. 4 calories of energy is generated from 1 ...
Q: Which of the following statements best describes the role of the enteric coating on aspirin tablets,...
A: Aspirin, also known as acetylsalicylic acid, is a drug that can be used to relieve pain, minor aches...
Q: BIM-46187 is a protein inhibitor that binds to the a-subunit of the G. protein. It prevents the GDP/...
A: Cell signaling is the conversion of the information in a signal into cellular response. Ligands, rec...
Q: Choose ONE of the bond types listed below which most accurately describes the bonds involved in stab...
A: Proteins are macro-molecules that are made up of amino acids. Amino acids are the basic structural a...
Q: Glucose can be isomerized to fructose to glucose isomerase. The enzyme kinetics of this enzyme was s...
A: From the Given Data, I have plotted the XY plot where, 1/S is on X-axis and 1/V on Y-axis. This is c...
Q: Which test can be used to differentiate maltose and sucrose? Molisch Test Seliwanoff’s T...
A: Molisch Test : Detection of carbohydrates Seliwanoff’s Test : Distinguishes between ketose, aldose ...
Q: what substances interfere with the tests for fructose? for lactose?
A: Seliwanoff's test is the qualitative test for the detection of ketose sugars in a sample. The ketose...
Q: I. Qualitative Analyses of Proteins Complete the table below. Chemical/reagent used (be specific) Fi...
A: Answer of above solution is:
Q: Biology Section 12BC / School Year / We. kl197624 All changes saved 8. In Labrador Retrievers, coat ...
A: The term epistasis refers to a type of gene interaction when one gene masks or modifies the expressi...
Q: Q5) A 3.0-mCi source of 3"P is implanted in a tumor to give it a 24-Gy dose. The half-life of 2p is ...
A: In question 3.0 mCi source of P32 is implanted to give 24-Gy dose of radiation to tumor cellHalf lif...
Q: Kindly answer 16, 17, 18, 19, and 20. Provide the letter of its answer
A: 16.The correct option is (c) Phosphatidylcholine 17. The correct option is (a) Membrane lipids
Q: Which amino acid in globin proteins is responsible for binding oxygen? Question 33 options: Gl...
A: Hemoglobin is the protein which helps in oxygen transport in the body. Hemoglobin is composed of a p...
1. For each of the sequences given below, list what type of secondary structural element, if any is most likely to be formed by that amino acid sequence.
1a. SEGEWQLVLHVWA
1b. GKGPPGPPGPRGPC
1c. CHSRHPGDFSC
1d. ASVRMNLGF
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
- 6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
- 1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…Which of these single strand RNA sequences could form a hairpin secondary structure? 5' AAAAAAAAAAAAAAAAAAA 3' 5' ACACACACACACACACAC 3' 5' CCCGGGGUUUUCCCCGGG 3' 5' UUUUUUUUUCCCCCCCCC 3' 5’ UUUGGGUUUGGGUUUGGG 3’1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAU
- 3. List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle cell hemoglobin:Normal: GGG CTT CTT TTTSickle: GGG CAT CTT TTTa. Transcribe and translate the normal and sickle cell DNA. b. Identify this as a point or frameshift mutation. Explain. c. If the base sequence read GGG CTT CTT AAA instead, would this result in sickle cell hemoglobin? Explain.1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)