List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…
A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…
Q: A faulty protein is found in the cell. A further investigation proved that the DNA sequence in the…
A: The collection of proteins among a cell determines its health and performance. Proteins are…
Q: Describe the process of protein synthesis and associated post translational modifications.
A: Post-translational modification (PTM) refers to the covalent and generally enzymatic modification of…
Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…
A:
Q: Protein: Hemoglobin Circle and underline each codon, amino acid sequence, make a mutation of the 3rd…
A: Here the not cleared the mutation type, are point mutations, frame shift mutation, addition mutation…
Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…
A: Mutation - Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…
Q: Name X and state how it functions in a protein synthesis. e) Give three differences between…
A: There are two strands which are anti parallel to each other which means they have opposite polarity,…
Q: Fill in the blanks: __________ are segments of DNA that code for a specific protein, and the human…
A: DNA (DEOXYRIBONUCLEIC ACID) It is a molecule composed of two polynucleotide chains that coil around…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: What mRNA is transcribed from each DNA sequen а. 5'-GTTCTАС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' с.…
A: The method of constructing an RNA copy of a genetic sequence is known as transcription. That copy,…
Q: The dna is CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG what is the mRNA and A.A.?
A: Thank you for the question Answer :- The process of conversion of DNA to mRNA is called as…
Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?
A: The sequence of a protein is usually notated as a string of letters, according to the order of the…
Q: the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true…
A: The synthesis of a functional protein involves two processes namely transcription and translation.…
Q: The 20 different amino acids in the protein are normally coded by ------ nucleotides. * 60 61 62 63
A: Nucleotides are building blocks of nucleic acids. Three mRNA nucleotides present together are known…
Q: List the 4 types of protein modification and describe each in 1 sentence
A: Protein modification refer to any change in the chemical composition of proteins following…
Q: Please describe the events that may result in a mature protein not having methionine as the…
A: Translation process of formation of a sequence of amino acid using messenger RNA as a template.
Q: The codon is found on mRNA? True or False?
A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…
Q: How to use the Kd to determine the fraction of both bound proteins? The Kd is 0.05uM. protein 1 has…
A: In the question following quantity has been given Kd=0.05uM [P1]= 0.03 uM [P2]=0.05uM
Q: a) Identify three types of RNA and provide a description of each and the role they play in protein…
A: a. Mejor type or RNA is 1. Messanger RNA (mRNA) 2. Ribosomal RNA (rRNA) 3. Transfer RNA (tRNA)…
Q: 10. List three examples of stop codons. a) .. b) .... c)
A: Genetic code It is a dictionary that corresponds with sequence of nucleotides and sequence of amino…
Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…
A: Ans a. The type of mutation shown below is point mutaion. A point mutation or replacement is a…
Q: If the DNA gene is TAC GGT TTA CAG, which amino acids will be put together?
A:
Q: Which of the following sequences is most likely to represent a beta-sheet portion of a protein? O…
A: The β-sheet is a secondary structure motif of the protein structures. it is formed by the β-strands…
Q: what is the the function of the protein related to KGD1
A: KGD1 is referred to as the mitochondrial alpha ketoglutarate's subunit. It is a very important…
Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…
A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…
Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…
A: No, this mutation might not change the way in which the protein functions. In this mutation the…
Q: The change of one conformation of protein to another is called a. allosteric transversion b.…
A: Option b Allosteric transition
Q: The strength of ligand-protein binding is a property of the binding site called --------------
A: Protein has region to which ligand binds, this region is called binding site or active site . Amino…
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: Why do some genetic mutations lead to completely nonfunctional proteins while others do not affect…
A: A mutation is a sudden change in the sequence of DNA. DNA is made up of nucleotides. DNA is…
Q: Gene are made of what
A: The genetic material is responsible for the inheritance of characters from one generation to the…
Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…
A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…
Q: What's the mRNA sequence? amino acid sequence?
A: Mutated DNA Sequence - TACGACCTTGGCGACGACT mRNA Sequence - AUG CUG GAA CCG CUG CUG A Amino Acid…
Q: Why is knowing the protein sequence important?
A: All proteins in all three classes of organisms i.e bacterial, archaeal, and eukaryotic—are…
Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…
A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…
Q: What are the different types of RNA and their contributions to the process of Protein Synthesis?
A: a. messenger RNA (mRNA) b. ribosomal RNA (rRNA) c. transfer RNA (tRNA)
Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?
A: The sequence of a protein is notated as a string of letters, according to the order of the amino…
Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?
A: CAT CTA CAA ATA GCA CCT AAT TGT G (DNA)
Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: What would the effect be on the protein you made if you made a mistake when you transcribed the DNA…
A: Point mutation Change of one base of nucleotide in DNA sequence is known as point mutation.
Q: would a nonsense mutation at the beginning of the gene, or at the end of the gene, have a greater…
A: Any heritable changes in the sequence of the genetic material of an organism are known as mutation.…
Q: ase describe the structural components of a gene?
A: Genes specify the structure of proteins that ar liable for the phenotype related to a selected gene.…
Q: State if/how Remedios' mutation changes the amino acid sequence and describe the effect that change…
A: CAT codes for HISTIDINE. CGT codes for ARGININE Since the mutation has changed the final amino acid…
Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…
A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…
Q: If you have the same protein loaded in two different lanes of an SDS-PAGE stained with Coomasie…
A: SDS-PAGE stands for sodium dodecyl sulfate-polyacrylamide gel which is an analytical technique used…
Q: A mutation leads to a change in one amino acid in a protein. The result is that the protein no…
A: Genome is a dynamic in nature. It is subject to inheritable genetic change. A sudden inheritable…
Q: How is a protein made inside the cell, from the very start until when it is shaped and packaged?
A: Proteins are an important biomolecule made up of long chains of amino acids. They are important for…
Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…
A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…
Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…
A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…
3. List the amino acid sequence of the protein coded for.
CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
Step by step
Solved in 4 steps with 1 images
- 1. Please describe the structural components of a gene?1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
- 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of the following amino acid replacements? a. Trp to His b. Met to His4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3'1. A tRNA to which the correct amino acid has been attached is called?
- 4. The strength of ligand-protein binding is a property of the binding site called --------------30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.