1. Point mutations are changes to a single base/nucleotide in the DNA sequence of a gene. This sequence change can alter the protein made from the gene in different ways depending on the type of mutation (missense, nonsense, synonymous/silent, frameshift, and loss of stop). Below is an mRNA sequence and its translated protein. For each question, select a single base/nucleotide in the ne result in the indicated mutation (note: more than one answer may be corr one) Normal Sequence: mRNA: 5' protein: GCACGU-AUG-UAC-GGG-CAU-ACA-UGA-UCGGACC 3' Met Tyr Gly His Thr Stop Nonsense Mutation: mRNA: 5' GCACGU- Protein: Silent/Synonymous Mutation: mRNA: 5' GCACGU- Protein: position U 2nd poston UCAG Phe Phe Ser Ser Leu Leu Ser Ser Tyr Cys Cys stop Trp Leu Leu C Leu Pro Leu Pro Alle lle Thr Asn Thr Asn Val G Val Val Val Pro His Pro His Gin Gin Th Met Thr Tyr stop stop Ala Ala Lys Lys Asp Asp Arg Arg Arg Arg Ala Ala Glu Amino Acids Ser Ser Arg Arg Gly Gly Glu Gly Gly 3rd U A G G >< G

1. Point mutations are changes to a single base/nucleotide in the DNA sequence of a gene. This sequence change can alter the protein made from the gene in different ways depending on the type of mutation (missense, nonsense, synonymous/silent, frameshift, and loss of stop). Below is an mRNA sequence and its translated protein. For each question, select a single base/nucleotide in the ne result in the indicated mutation (note: more than one answer may be corr one) Normal Sequence: mRNA: 5' protein: GCACGU-AUG-UAC-GGG-CAU-ACA-UGA-UCGGACC 3' Met Tyr Gly His Thr Stop Nonsense Mutation: mRNA: 5' GCACGU- Protein: Silent/Synonymous Mutation: mRNA: 5' GCACGU- Protein: position U 2nd poston UCAG Phe Phe Ser Ser Leu Leu Ser Ser Tyr Cys Cys stop Trp Leu Leu C Leu Pro Leu Pro Alle lle Thr Asn Thr Asn Val G Val Val Val Pro His Pro His Gin Gin Th Met Thr Tyr stop stop Ala Ala Lys Lys Asp Asp Arg Arg Arg Arg Ala Ala Glu Amino Acids Ser Ser Arg Arg Gly Gly Glu Gly Gly 3rd U A G G >< G

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
1. What would be the amino acid sequence encoded by the mRNA5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)
3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different colors, the direction, its components and the part of the cell where it occurs with the name of this stage. b) The sequence of the mature mRNA, indicating with different colors the structure of its components and the site of the cell with the name of the stage where it occurs. c) Mention the site of the cell where the bradykinin peptide was synthesized. d) In the DNA sequence make a point mutation by substitution, indicate with a different color the site and the effect it will have on the respective codon and to which amino acid it will be translated. 2. Based on the answer in (a), use the DNA sequence of bradykinin to describe the outcome of the replication step. 5. You have the picture of DNA transcription and mRNA translation between prokaryotic and eukaryotic cells.Instruction: Make a comparative chart showing the differences between the two cells. (image) 7. Methylations. Describe…
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above