1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…
A: The protein synthesis occurs in cytoplasm by the process of translation.
Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: 5. Answer the following questions concerning protein synthesis a. Describe with drawings how…
A: Protein synthesis is known as translation process that perform synthesis of amino acid chain or…
Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…
A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…
Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…
A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…
Q: 6. Please describe the events that may result in a mature protein not having methionine as the…
A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…
Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…
A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…
A: The translation is a process by which proteins are synthesized. It is the last step of the central…
Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…
A: Transcription and translation are the components of gene expression. These two processes are known…
Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…
A: Gene expression is the process by which the instruction in the DNA is converted to products through…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: 1. What are the types and major functions for each type of RNA?
A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…
Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC
A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…
Q: 2. Identify the following structures when given images such as the ones below: ● process of…
A: Introduction The cell is the basic structural and functional unit of life present in all living…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…
A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.
Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…
A: Answer : Given in the image
Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…
A: This question we have to describe about process of translation.
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…
Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…
A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…
Q: 8.) Answer the following questions regarding the following DNA sequence.…
A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…
Q: A tRNA to which the correct amino acid has been attached is called
A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…
Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…
A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…
Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation
A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…
Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.
A: 7. In all living organisms, the material that contains the information which is transmitted from…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…
A:
Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…
A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…
Q: AAA CC GG G CA GG CCGU Phe Gly Arg
A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…
Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…
A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…
Q: 1. Decoding mRNA into amino acids is called translation.
A: above given statements are about transcription, translation process and how amino acids makes a…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…
A: Genetic code is a set of three nucleotides where one triplet is called as one codon.
Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…
A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…
Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…
A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
- Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of eachTranscribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
- Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOPThe DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’
- DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain: b. the leftsummarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
