asap please 1. Use the plasmid shown to complete the table.# ofFragment SizesRestrictionEnzyme UsedFragmentsProducedEcoRI onlySmal onlyEcoRI and1680 bpSmal togetherSketch the gel produced for all three scenarios above.2. Use the linear piece of DNA to complete the table and then sketch the gel for all threescenarios.HindIIIBamHI HindIIIBamHIEcoRISmal1790 bp0/2800 bp550 bp700 bpSmalEcoRI

We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Answered: 1. Use the plasmid shown to complete…

1. Use the plasmid shown to complete the table. # of Fragment Sizes Restriction Enzyme Used Fragments Produced EcoRI only Smal only EcoRI and 1790 bp 0/2800 bp 1680 bp 550 bp 700 bp Smal EcoRD

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 6SQ

See similar textbooks

Related questions

Q: . Which hormones control the level of glucose in the blood?

A: Introduction :- Hormones are signalling chemicals that are carried to distant organs by…

Q: Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? In…

A: Both DNA replication and Polymerase Chain Reaction are processes that are used to produce copies of…

Q: Summarize the major functions of the respiratory system

A: The respiratory system involves the complex network of tissues and organs that helps in gas exchange…

Q: 1). Penguins in Stewart Island have a recessive mutation "twist-tail" that causes problems in the…

A: Introduction :- Homozygous refers to an organism having two copies of the same gene allele. If an…

Q: Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? In…

A: DNA replication and Polymerase Chain Reaction are both processes that create copies of DNA. DNA…

Q: GOOOOO In double fertilization, one sperm fertilizes cells in the ovule; the egg cells in the pollen…

A: Introduction Double fertilization is an unique fertilizing method that has evolved in flowering…

Q: Explain what functions spectrins impart on red blood cells?

A: A large, cytoskeletal, and heterodimeric protein is called spectrin. It consists of α and β…

Q: Briefly discuss the secondary vesicles in the embryonic development.

A: Embryonic development in other terms is called as the embryogenesis is the process of development…

Q: What can you conclude about the structure of mitochondria

A: Mitochondria are the most important organelles of the cell, they generate the energy that is…

Q: Describe the structural features of the human immunodeficiency virus and the host cell membrane that…

A: Structural features of HIV virus Human immunodeficiency virus shape :spherical. (cone-shaped)…

Q: 1). Penguins in Stewart Island have a recessive mutation "twist-tail" that causes problems in the…

A: Penguins in Stewart Island have a recessive mutation "twist-tail" that causes problems in the…

Q: Evolutionary biologist Neil Shubin once said, "In one sense, evolution didn't invent anything new?…

A: Introduction While some features are derived from wholly new mutations that result in altered gene…

Q: Which of the following are the three important questions that should be considered when explaining…

A: Human-environment interaction refers to the mutual relationship between the natural environment and…

Q: how are microorganisms are involved in the production of lagers?

A: Brewing lager is one of the most complicated and difficult brewing process. There are many major…

Q: Which of the following is a chemical link between catabolism & anabolism? O GTP O FADH2 O PEP O…

A: Catabolism is a set of biochemical reactions that break downs larger biomolecules like…

Q: In Type I diabetes, the Beta cells of the pancreas produce little to no insulin. What effect does…

A: In type 1 diabetes our immune system attack and deatroy our insulin producing beta cells of…

Q: What is the amount (mL) of pre-culture (108 cell/mL) necessary to inoculate (to add) in a 2-liter…

A: A solid or semisolid substance used to support the growth of microorganisms is known as culture…

Q: when preparing the slide. The student used an eyepiece graticule to calculate the size of some of…

A: Ocular units are the spaces on the ocular micrometre or eyepiece graticule, and stage units are the…

Q: List all the features of a mammalian promoter.

A: Promoters are located immediately upstream of the gene and are critical in determining whether…

Q: What are the organs upper end and lower ends of oesophagus connected to?

A: Introduction :- The oesophagus is a component of the digestive system, sometimes known as the…

Q: Describe the proper technique for performing reagent strip testing.

A: The reagent strip testing is a urine test.

Q: Why is genetic engineering such a controversial ethical issue? How would you assess the importance…

A: Genetic engineering is the booming branch of science. At the same time it is highly controversial…

Q: For each example, identify the protein's function in the body. Actin is the major component of thin…

A: Introduction Protein is a macronutrient that is essential to building muscle mass, They serve a wide…

Q: Make a TABLE (containing the summary) of the stages of emrbyonic development with each of the…

A: Embryogenesis is a process of development of the embryo from the zygote , the processes involved…

Q: Which wavelength of visible light is absorbed the most by the leaf.

A: Chlorophyll and carotenoids are pigments present in leaves. Chlorophyll is primarily involved in…

Q: how are microorganisms are involved in the production of lagers?

A: Lager is a kind of beer that has been blended and molded at low temperatures. Lagers can be pale,…

Q: | | || | || a. Label each lane of the gel. Write only the corresponding letters in the wells above.…

A: Introduction Gel electrophoresis is a laboratory technique for separating DNA, RNA, and protein…

Q: 1- Depending on the enzymatic method in DNA isolation, What is the defending mechanism of our eyes…

A: During DNA replication, the complete double helix of DNA is gradually unwound, resulting in…

Q: Describe the types of muscle-bone attachments?

A: Muscles and bones both are useful for maintaining the stability in the body. Muscles consists of the…

Q: Please describe the important events that occur at each stage: 1. Interphase a. G1 b. S c. G2 2.…

A: cells divide in our body , for some organisms cell division is the process of reproduction like…

Q: how are microorgan

A: Microbial fermentation produces alcoholic beverages.

Q: A complex phenolic compound that is secreted and deposited in the secondary cell wall that provides…

A: In this question we have to describe about vascular plant and their some specialized character. See…

Q: 5) There are several coronaviruses in the database, why is the SARS-CoV-2 so dangerous?

A: WHO declared the COVID-19 eruption, caused by severe acute metabolic process syndrome coronavirus-2…

Q: substrate active site لا substrate tw enzyme enzyme enzyme-substrate complex . What is a catalyst? .…

A: Introduction :- A catalyst is a substance, such as an element or a molecule, that speeds up chemical…

Q: Define two fungal pathogens, and also write its morphological characterization.

A: Pathogenic organisms are most part of intracellular microbes, demonstrating at sooner or later…

Q: how are microorganisms are involved in the production of lagers? include the process of…

A: Introduction Lager is a kind of beer that has been blended and molded at low temperatures. Lagers…

Q: Select one abiotic and one biotic factor in an area where a herd of cows reside. How does these…

A: Abiotic factors vary among the world's ecosystems. A better understanding of these factors can be…

Q: 1). Penguins in Stewart Island have a recessive mutation "twist-tail" that causes problems in the…

A: Hardy-Weinberg Equilibrium is a concept that serves as a benchmark for researchers to analyze gene…

Q: 'Only those who risk going too far can possibly find out how far they car go." Explain this quote in…

A: "Only Those Who Risk Going Too Far Can Possibly Find Out How Far They Can Go" This quote has very…

Q: 5. A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…

A: A genome is a full set of genetic material found in an organism. Deoxyribonucleic acid (DNA) is a…

Q: 1.Discuss how the term sustainable development emerged? 2. Discuss Kyoto Protocol (1997) vs. Paris…

A: Global warming is the major environmental issue in which the earth's temperature rises at an…

Q: Answer Everything. Kindly skip if you're not interested to answer them. Read Chapter 12 of Egan's…

A: Oxygen is transported around the body by hemoglobin, which is found in red cells. Oxygen does not…

Q: In otters fur colour can be either yellow or brown, and is determined by two alleles of the C gene.…

A: In otters, fur color can be either yellow or brown and is determined by two alleles of the C gene.

Q: The body plan of an annelid displays meaning that the body is divided into a series of repeated…

A: The phylum Annelida is an invertebrate phylum. Annelids are triploblastic coelomates with bilateral…

Q: All steps in the calculations must be reported, incomplete reporting of these leads directly to…

A: Acetyl coenzyme acts as an allosteric activator of enzyme pyruvate carboxylase. This enzyme adds CO2…

Q: what is the main parts in clinical chemistry that be important in * manual and automated method

A: Clinical chemistry deals with the biochemical analysis of body fluids to determine the amount of…

Q: 1. The dominant stage in the life cycle of ferns, horsetails and whisk ferns. 2. This refers to a…

A: Vascular plants are the plants ,which contain vascular tissues like xylem and phloem,which is able…

Q: Which of the following is a chemical link between catabolism & anabolism? O GTP O FADH2 O PEP O…

A: Catabolism is a set of biochemical reactions that break downs larger biomolecules like…

Q: Briefly discuss the secondary vesicles in the embryonic development.

A: Embryonic development in other terms is called as the embryogenesis is the process of development…

Q: how are microorganisms are involved in the production of lagers? include the process of…

A: Introduction Lager is beer which has been brewed and conditioned at low temperature. Lagers can be…

Concept explainers

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.

Question

asap please

1. Use the plasmid shown to complete the table.
# of
Fragment Sizes
Restriction
Enzyme Used
Fragments
Produced
EcoRI only
Smal only
EcoRI and
1680 bp
Smal together
Sketch the gel produced for all three scenarios above.
2. Use the linear piece of DNA to complete the table and then sketch the gel for all three
scenarios.
HindIII
BamHI HindIII
BamHI
EcoRI
Smal
1790 bp
0/2800 bp
550 bp
700 bp
Smal
EcoRI

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

83. A plasmid is cut with the restriction enzyme BamH1 giving fragments of 3000 and 1000 bp as identifiedby gel electrophoresis and ethidium bromide staining. In a seperate restriction digest the enzyme EcoR1gives fragments of 1000 and 1500 bp that are apparent on the agarose gel. What is the most likely size ofthe plasmid in bp? Explain why it's 4000
Give a major disadvantage of RAPD as a DNA marker. Provide one (1) recommendation onhow to address this limitation. Briefly discuss. (in 5 sentences only)
DNA samples were then run in agarose gel electrophoresis against a molecular standard of 100 bp and 1Kb Ladder. The figure is analyzed and labelled manually and recorded with the used product ladder information. Figure 2A is labeled with corresponding lane numbers and with M1 and M2 as markers used. Write an interpretation of the documented gelresult (Figure 2). Note: Agarose gel of isolated DNA (A) from plant (lanes 1 & 2), chicken (lanes 3 & 4), and E. coli (lanes 5 & 6) with Vivantis* product information of 100bp (B) and 1kb ladders (C).
During DNA profiling, DNA nucleotides hybridized with probe can be detected througha) Electrophoresisb) Polymerase chain reactionc) Autoradiographyd) Hybridoma
Please answer the following using the experiment data below. Provide the formulas or methods used for calculations of each. Number of colonies on LB/amp/ara plate = Micrograms of DNA spread on the plates = Transformation efficiency = DNA plasmid concentration: 0.08 μg/μl 250 μl CaCl transformation solution 10 μl pGLO plasmid solution 250 μl LB broth 100 μl cells spread on agar 227 colonies of transformants
You have two sewage samples that you want to check for the SARS Cov 2 viral load. Whichvariable would give you a good estimate?a. High Ct valueb. Low Ct valuec. High melting temperatured. Low melting temperaturee. None of the above The DNA fragments generated during a cycle sequencing reaction are separated by sizes usingcapillary gel electrophoresis. The determination of the actual sequence is based on detection ofa. fluorescently labelled ddNTPsb. the lengths of the fragmentsc. fluorescently labelled probesd. fluorescently labelled primers.
Entire sequence below needs to beamplified by PCR and subcloned into a plasmid vector. Which of the primersequences listed underneath is the correct reverse primer (6 marks)? Copy correctsequence into your answer. Why primer e) is not the right answer (4 marks)? 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'a) 5' TTCCGGAAGAAGCTTATACGG 3'b) 5' CTGTGTTCACCTAATATTCCT 3'c) 5' CAGCAGGAGACGCGTCGGTGA 3'd) 5' AGGAATATTAGTATAATCCAC 3'e) 5' GACGCGTCGGTGATGTTCGGG 3’f) 5'…
Attached is an image of EcoRI-digested plasmid samples (pBSK and pEMBL1.9); explain why the bands are found at the top, the purity of the results, and how we couple improve our results.
1. a) A technologist has a 20µl sample of DNA and adds 5µl of loading dye before adding the total volume into an agarose gel. What was the original concentration of the loading dye? a. 4x b. 5x c. 6x d. 7x e. None of the above 1. b)A technologist adds 6uL of 5x loading dye to a DNA sample before adding the total volume into the agarose gel. How much DNA sample was combined with the loading dye? 12uL 16uL 20uL 24uL 28uL
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI
7) Why are the following reagents used? Neutralizing solution (Plasmid isolation) Isopropanol (Plasmid isolation) RNase (isolation of genomic DNA)
A student wanted to load .75 ug dna on agarose gel and has 4x loading buffer for sample preparation. The student has 50ul purified plasmid, finding concentration of plasmid to be 250 ng/uL The student used 10uL plasmid DNA in 50uL reaction for the restriction digest Give the volumes of restriction digest and 4x loading buffer that student would mix together and load on agarose gel.