1. What are the possible sources of error in the measurement of CK and LDH activity? 2. What is responsible for the false elevations of CK levels in hemolyzed samples?
Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…
A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…
Q: Select one specific compound representing a larger metabolite group (e.g. menthol for terpenes),…
A: There are several primary and secondary metabolite secreted from the plant as defense compounds. One…
Q: ? O A. Cornea OB. Iris OC. Pupil
A: This structure / diagram is that of an eye. Eye have various components. Question has asked the…
Q: The Tropical regions are likely to have more biological diversity than the Temperate ones. Give two…
A: Biome is the distinct ecological community of animals and plants that exist together in a particular…
Q: 1. The recessive Drosophila mutation bobbed (b) is located on the X chromosome and causes short…
A: This evaluation can be made by using punnett square.
Q: estions 1-2: Describe an appropriate control for each of the following. An investigator studies the…
A: In an experiment control is used when the independent variable is removed or set at standard value.…
Q: 6. What are carbohydrates? * O Different combinations of amino acids O Lipid monomers held together…
A: Macromolecules are large, complex molecules that are essential to the structure and function of all…
Q: I was told the correct answer is 0.006. Please advise why this one is diffrent
A: Introduction The fundamental piece of genetic information given from parent to child is the gene.…
Q: Compare and contrast life cycles of plants (pteridophytes, gymnosperms, angiosperm), animals, fungi…
A: Life cycles describe the progression of developmental stages that an organism goes through, from its…
Q: How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel…
A: Pulse-chase analysis is a method used to study protein synthesis and turnover in cells. In this…
Q: 2. Match the correct molecules with the checkpoints below. a. Molecules important for regulating…
A: There are various phases in the cell cycle and various checkpoints present so that if the DNA is…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: 1. On your ovulation chart, mark the unfertile, likely to be fertile, and the most fertile days. Put…
A: Menstrual liquid comprises blood, endometrial cells (uterine lining cells), and mucus. Menstruation…
Q: presented in this MMWR article, explain the trends that were seen with giardia infection across the…
A: The trends seen with Giardia infection across the nation from 2011-2012 showed an overall decrease.…
Q: What is a technique often used to study the three-dimensional structure of proteins? A.X-ray…
A: Proteins are made up of amino acids, which is the primary structure of proteins, the secondary…
Q: a. To make a 300mL of 1% NaCl, weigh cylinder, and add water to make the total volume b. To make a…
A:
Q: Choose an example of evolution that we have discussed in class. Use this example to demonstrate that…
A: Evolution is the process by which different species of organisms develop and change over time. It is…
Q: Deoxyribose sugar Thymine Guanine Phosphate Hydrogen bonds [Choose] [Choose [Choose ] [Choose ]…
A: DNA It is Deoxyribose Nucleic acid. It constitutes two polynucleotide chains that wound around each…
Q: Which of the following are forms of DIRECT transmission? Question 18 options: a) bite of…
A: Direct transmissions are-- b. Sex e) touching another person h) talking closely with someone g)…
Q: Why is there loss of protein synthesis in hypoxic injury to a cell?
A: Protein synthesis is the process by which cells use genetic information to build and assemble…
Q: What Moniclonal antibody topics can one do research on ?
A: Monoclonal antibodies are proteins that imitate the immune system's capacity to combat harmful…
Q: Briefly describe multiple sclerosis. Include information about the location of lesions, aetiology…
A: Multiple sclerosis (MS) is a central nervous system illness, which means that it damages the brain…
Q: You inspect an ear of corn and find the following number of kernels: 461 red and starch, 142 red and…
A: Genotype is the genetic constituent of an organism. It is a specific genetic makeup of an organism…
Q: Which of the following statements is true about NHEJ (Non-Homologous End Joining) repair? a. This is…
A: Non-homologous end joining(NHEJ) is basically a repair pathway.It mainly repairs double-strand…
Q: 9. For organism Z, 2n = 36. What is the diploid chromosome number (2n) and DNA content (C) of…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Part II-A New Dilemma Suzanne and David decided that Suzanne would take the diagnostic test. In…
A: Both decided for Suzanne to undergo the diagnostic procedure. Suzanne and David are now faced with a…
Q: Using the techniques below in the laboratory experiments, devise a detailed methodology in solving…
A: DNA testing and analysis can identify an individual's unique genetic makeup and help tailor…
Q: Can you Describe in 1500 words, Planning Cycle for a Health Program?
A: Health program basically means to provide basic preventive ideas to prevent the spread of…
Q: Per the book the answer to this questions is probability is 0.006.
A: The cross is between parents having genotype AaBb x Aabb. This genotype will produce four and two…
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) the origin of…
A: DNA is a double stranded molecule. DNA replication is Semi conservative. This means that each DNA…
Q: Given a chance to become a bioentrepreneur, which of the plant products will you be able to place in…
A: The question is about a hypothetical scenario in which a person has the opportunity to become a…
Q: What is the difference between quantitative and qualitative analysis? Give several examples. Define…
A: Quantitative analysis : Quantitative analysis is expressed in numbers and graphs. It is used to test…
Q: Distinguish between sensory and motor pathways in terms of direction and type of information…
A: In motor pathways the direction of information flowed from the cortex to the spinal cord and motor…
Q: Interactions of Agrobacterium tumefaciens with its host plant. Please describe how this plant…
A: Agrobacterium tumefaciens is a bacterium that infects dicotyledonous plants and produces crown…
Q: Genetic and genomic research can have social and environmental implications.
A: Genetic modifications do have environmental implications which can be observed from the given graph.…
Q: 1. Following Glycolysis, the second stage of cellular respiration is the Krebs (or citric acid)…
A: The Krebs cycle or TCA cycle or tricarboxylic acid cycle or Citric acid cycle is a series of enzyme…
Q: The waved albatross feeds exclusively on marine organisms and has no access to fresh water. It has…
A: Albatrosses have salt glands just behind their eye sockets. This salt gland allows them to get rid…
Q: Is it possible for two parents with achondroplasia to have a average height son (if so how often…
A: One in 20,000 infants have the inherited bone disease achondroplasia. The youngster has the most…
Q: What controls the direction of movement of ions across the membrane? A. Peripheral proteins B.…
A: The creation of ion gradients across the plasma membrane is necessary for the flow of ions through…
Q: Describe what a pseudogene is and what impact they have on gene expression
A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.
Q: 2. Which of the following is NOT part of a nucleotide? O Phosphate O Sugar O Glycerol Nitrogenous…
A: As the question contains more than one questions, here we have answered the second question.…
Q: What is the most common portal of entry? Question 12 options: a) food & water b) mucous…
A: E. Respiratory aerosols
Q: The nurse practitioner prescribed 500 micrograms of Risperidone. The stock solution available in a…
A: Risperidone is an atypical antipsychotic medication used to treat schizophrenia and bipolar…
Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: Considering its metabolic properties, what advantage might the phototroph in the “Chlorochromatium…
A: Introduction: A phototrophic consortium known as Chlorochromatium aggregatum may be the highest…
Q: Make clear your understanding of polyneuropathies by providing the type of structure affected (its…
A: Nerves allow us to feel and respond to our environment. Nerves control the muscles, allowing us to…
Q: How does pollination take place in water hyacinth and water lily
A: Pollination: The process of transfer of the pollen grains from the anther which is the male…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: B. Write the function/s of each part of the microscope listed below. a. Eyepiece b. Draw tube c.…
A: An instrument, microscope is used to observe tiny objects even cells. It examines the objects that…
Q: X-ray crystallography is time-consuming and technically difficult. Why is the effort to understand…
A: biological molecule worthwhile helps to understand the fundamentals of biochemical processes…
Step by step
Solved in 3 steps
- 1. Name the other methods of ESR determination with its corresponding anticoagulants and normal values. 2. What are the factors favoring slow ESR? NOTE: Kindly answer all question. Thank you!1: Name the standard method for the determination of Erythrocyte Sedimentation Rate ESR. b: Name two conditions in which ESR is raised. c: State the principle of the test. d: Explain the mechanism of the test. e: What is the clinical significance of the test. f: State two precautions to be observed during the test. 2: State the principle for the determination of Hb using the haemoglobincyanide method. b: Given that the vol of blood taken is 20uL, and the vol of the diluting fluid is 5.0ml. Calculate the dilution factor.1.Coversyl 5mg, Doxepin 25mg daily, Atorvastatin 40mg daily . Provide the mechanism of action, side effects correct dosage and contraindications for each medication. Explain how this might affect Geraldine in the post-operative period 2.. Using the Roper-Logan Tierney Model, identify one (1) potential cultural/biopsychosocial issue/problem and discuss how this will affect the patient post-operatively or on discharge Incident: 72 yr old female Mrs Geraldine Berry sustained left fractured neck of femur (#NOF) and laceration to her head 5cm while walking her dog. Tripped on an uneven pathway. PMH: Hypertension and depression Current Medications: Coversyl 5mg Doxepin 25mg daily Atorvastatin 40mg daily SHx: Lives with elderly husband. Is the primary carer for elderly husband who has had a stroke previously and is mildly impaired. Attends church every Sunday and is responsible for arranging flowers for every Sunday service. She has started volunteering at the St Vincent De Paul’s Meals on…
- Mrs B, aged 43 years, weight 56 kg, requires a loading dose of drug B. The target plasma concentration is 18.9 mg/ L, volume of distribution is 0.5 L/ kg, the salt factor is 0.9 and bioavailability fraction is 1. What is the intravenous loading dose (LD) of Drug B in milligrams (mg)? units - mg LD = Cp desired x Vd S x F Where Cp desired is the target plasma concentration; Vd is the volume of distribution; S is the salt factor and F is the bioavailability fractionA lady who has been working as a nuclear medicine technician for 30 years is diagnosed with colon cancer. She is a nonsmoker and known of no exposure to other risk factors of colocancer. If the estimated excess relative risk of colon cancer in that lady is 0.11, their at the estimated probability of causation of colon cancer due to radiation in the lady?Beth R. (58 kg, 63 years old) is suffering from symptomatic ventricular arrhythmia. She will be started on an oral multiple-dose regimen with the antiarrhythmic mexiletine. The population average values of mexiletine for clearance and volume of distribution are Cl = 0.5 L/h/kg and V = 6 L/kg, respectively. Although a therapeutic range of 0.5– 2 mg/L has been described, avoiding large peak-to- trough fluctuations is recommended. The available oral dosage forms are 150, 200, and 250 mg capsules with an oral bioavailability of 0.9%. Design an appropriate and practical oral-dosing regimen that keeps the plasma concentrations at an average concentration of approximately 1 mg/L, with a peak-to-trough fluctuation of less than or equal to 100% (between 0.75 and 1.5 mg/L). What dosing regimen should be used? A. 150 mg every 6 hours B. 200 mg every 6 hours C. 200 mg every 8 hours D. 250 mg every 8 hours
- A 53 YO adult male weighing 168lb, who is being treated for VZV encephalitis, has been prescribed acycloivr 10mg/kg/dose IV q 8h for 10 days. Acyclovir for injection is availble in 10 and 20 mL vials containing 50mg/mL. a) How many mg will the patient receive each day? b) How many mg will the patient receive each dose? c). How many mL will the patient receive each dose?Provide a disccusion of the treament/managment on microsytic anemia. A 25-year-old female who is seen ot be pale and lethargy Give detail example of current and new cutting edge treasments/ clincial trials. Provide current data of effects of treaments.2. What will be the effect in prothrombin time if the patient is receiving therapeutic heparin? 3. Prothrombin Time is performed diagnostically when any coagulopathy is suspected. Explain the expected results of PT on the following coagulopathies: 3.1 Disseminated Intravascular Coagulation 3.2 Liver Disease SERUM PROTHROMBIN TIME 3.3 Vitamin K Deficiency 4. Illustrate and label the different steps of Serum Prothrombin Time.
- A patient taking ketoconazole, an antifungal agent, was also prescribed dofetilide to treat arrhythmias. The therapeutic window for dofetilide is 8–15 μg/mL. The patient’s serum levels are taken 48 hours after his first dose and his serum levels are 3 μg/mL. What is the cause of these reduced serum levels?1. Give the pharmacological approach in the ICU provided to patient TB for her hypertension. Explain its mechanism of action. her bp 161/85mmHg.Treatment with the drug carvedilol for heart failure is initiated with a dose of3.125 mg twice daily and then increased every two weeks with twice-daily doses of6.25 mg, 12.5 mg, and 25 mg. How many of each of these tablet strengths shouldbe dispensed for this protocol?
