1. What is a casque? Which members of Casuariiformes have one, and what is though to be its function? 2. Please describe how cassowaries have weaponized their feet.

Q: Hydrophobic and hydrophilic: how do aquatic insects locomote on the surface of water?

A: Hydrophilic and hydrophobic The word Hydrophilic is a combination of two words i.e. "Hydro" which…

Q: Based on Figure 17-35, write a sentence stating howtranslocation can lead to cancer. Can you think…

A: Translocations were discovered cytologically for the first time in the late nineteenth and early…

Q: Channels for sodium ions in the cell membrane open and sodium flows into the cell Both channels for…

A: Action potential are basically nerve signals which results in sudden change in the resting membrane…

Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…

A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…

Q: As a young girl, Maria suffered a head injury that damaged her pituitary. An injury to the pituitary…

A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…

Q: Define disinfection. Compare/contrast it with sterilization, antisepsis and bacteriostasis.

A: Sterilization, disinfectant, antisepsis and bacteriostatic all terms are related to halt the growth…

Q: Illustration of stages in Meiosis 1 with 10 chromosomes, explain briefly

A: Meiosis is the cell division process that involves division of a diploid (2n) mother cell and…

Q: Which of the following statements about biotic potential is TRUE? Biotic potential of an organism…

A: Introduction Biotic potential:- It is the ability of a population of living species to increase…

Q: Bob is a 19-year old male, who is 6’3”, and weights 160lbs. You tested Bob’s 1.5-mile run time, and…

A: Absolute VO2 max is without a doubt the amount of oxygen you breathe in liters in line with a…

Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…

A: * Skeleton is the framework of  human body which is composed of 270 bones at birth and can be…

Q: The Earth’s atmosphere consists of 78% nitrogen. Why do you think that plants and animals can’t use…

A: Earth’s atmosphere contains a huge amount of nitrogen gas. But this nitrogen is unavailable to…

Q: Which of the following is true about neglected tropical diseases? Group of answer choices Though…

A: * Neglected Trophical disesase commonly seen  in countries like Africa and Asia and Latin America…

Q: An individual with an argininosuccinase deficiency is administered benzoate and arginine. This…

A: Argininosuccinase deficiency is a condition where the cells are devoid of an important enzyme i.e.…

Q: humectants as food additives.

A: Food additives Food additives are substances that when added to food increase their flavours, taste,…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: quality assurance

A:

Q: Okazaki fragments are short DNA pieces that explain how

A:

Q: Synthetic opioids are frequently being used for analgesia, i.e. as pain killers. While morphine or…

A: * Synthetic opioids used for analgesia as pain killers. *morphine and other agonists like fentanyl…

Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…

A: Evolution is the change in the characteristics of a species over several generations and relies on…

Q: Use what you know about inflammation to explain how periodontal organisms might be responsible for…

A: Suppose that bacterial plaque builds up in patient's oral cavity (on the teeth). This leads to…

Q: 13) Draw a graph representing the changes in membrane potential across the axonal membrane before,…

A: The electric signals that flow down the dendrites to form a nerve impulse or an action potential are…

Q: Name the two kinds of tissues present in the bone? a) Cancellous tissue and non-compact tissue b)…

A: Introduction - Compact tissue (the hard, outer layer) and cancellous tissue (the soft, inner layer)…

Q: What is the relationship between the severity of symptoms and the size of the chromosome involved in…

A: More the size of the chromosomes involved in the trisomy, more will be the severity of symptoms.…

Q: Q.2. Describe the individuals with the following chromosomal abnormalities: 1. Trisomy at chromosome…

A: 1) Trisomy - Trisomy results in Down's syndrome, which is an autosomal-linked genetic disorder that…

Q: (b) How is ATP converted to ADP by glucose? Explain. Why is there intake of phosphoric acid by…

A: Cellular respiration is a metabolic process in which glucose is converted into carbon dioxide,…

Q: Q.6. Comment on the statement with reference to industrial melanism, "Evolution is apparently…

A: Introduction We have to comment on the statement given in the question.

Q: What are the types of evolution

A: The various types of evolution are as follows:

Q: All herbivore species are small such as insects and would not be able to have massive muscular…

A: * Herbivores are organisms that feeds on plants and they can range in size from tiny insects like…

Q: The heptapeptide repeat in the carboxy terminal domain (CTD) in the RPB1 subunit of RNA polymerase…

A: Answer :- Option (D) is correct. - Initiate transcription.

Q: What is Pepsin

A: Digestion of food begins inside the mouth with the help of the enzyme salivary amylase and digestion…

Q: Which of the following are not true regarding Jacksonian March? Electrical activity jumps from lobe…

A: Option A - Electric activity jumps from lobe to lobe.  It is a false statement because seizure…

Q: (c) Draw the absolute configuration of Cholesterol. How Progesterone can be synthesized from…

A: Basic nucleus of cholesterol is formed by a sterol nucleus. This sterol nucleus is made of four…

Q: Which of the following would produce the fastest response to G-protein activation? а. cyclic GMP…

A: Secondary messenger/second messenger is the molecule, which is produced upon the activation of any…

Q: Which cell secretes the matrix for bone formation? a) Osteoclastoma b) Osteoclast c) Mesoblasts d)…

A: Introduction - The creation of bones is known as osteogenesis or ossification. Following the…

Q: Q.1. Enumerate the key concepts in the evolution theory of Darwin.

A: The two most important concepts in Darwin's theory of evolution are as follows:

Q: Q.3. Explain the terms: 1. Race 2. Breed 3. Cultivars 4. Variety

A: Animal husbandry is the department of science that deals with the exercise of breeding, farming, and…

Q: Detoxification of lipid drugs and other harmful compounds in ER is carried out by? a) Cytochrome D…

A: Introduction - Detoxification is the process of removing a drug of dependency from the body without…

Q: Which of the following is false when considering the CCR5Δ32 mutation? a) The mutation prevents the…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: QUESTION 2 The highest frequency sound is detected by unique hair cells located anywhere along the…

A: The inner ear is located next to the middle ear and is a double-walled structure. It has two main…

Q: A computer virus is capable of replicating itself.What other features of computer virus are similar…

A: Introduction A virus is a small piece of genetic material, such as DNA or RNA, encased in a protein…

Q: The enzyme hexokinase adds a phosphate toD-glucose but ignores its mirror image, L-glucose.…

A: Hexokinase is found in all metabolising cells of the body, whereas glucokinase is found in liver and…

Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I. A…

A: The replication is the process of producing double standard DNA molecule from the parental double…

Q: What are the primary and the secondary constrictions of a chromosome? What is the other name given…

A: Chromosome At the time of cell division the chromatin material get condensed to form chromosomes…

Q: la) with examples, distinguish between. Continuous and discontinuous variation. ii) Dominance and co…

A: Genetics is a branch of science that studies genes, genetic diversity, and inheritance in living…

Q: 10. Modified true or false: Write T if the statement is true; if false, write F, underline the word…

A: Plants are classified as flowering plants and non-flowering plants. Flowering plants are divided…

Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False

A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…

Q: A team of scientists study a microorganism that lives in a wetland region. The organism is an…

A: Introduction Obligate anaerobes are microorganisms killed by normal atmospheric concentrations of…

Q: Within an ecosystem, the total amount of energy produced initially by primary producers will be the…

A: Answer :- Option (A) is correct. - More than.

Q: The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly…

A: In eukaryotes, rRNA have a sigma factor which makes the self splicable and hence the highly variable…

Q: what is systematic, phylogenetic tree and phylogeny?

A: Phylogenetics is the observe of the evolutionary history of dwelling beings. Both principles are…

Evolutionary adaptations

Evolutionary adaptation is the process through which organisms adapt or adjust to their surroundings to increase the chances of survival, mating, and reproduction. An organism's behavior, physiology, and structure are adjusted or changed to make it more suited to its environment.