Why do megapodiidae have an incubating egg and what does it do? 2. How does being non-migratory affect galliforms' anatomy and physiology? 3. What is crop milk and when is it produced? 4. What are apteria? Do penguins possess them?

Q: .List out the characteristics of the chromosome theory of Inheritance.

A: The following are some of the most important characteristics of the chromosome theory of…

Q: Explain Down's syndrome.

A: Introduction In this question we will discuss about the Down's syndrome.

Q: Q.3. Explain the terms: 1. Race 2. Breed 3. Cultivars 4. Variety

A: 1. Race- Different phenotypic populations within the same species may be referred to as a race. It…

Q: Why are antibiotics not allowed in the treatment of rotaviruses?

A: Rotavirus  Rotavirus is a double stranded RNA virus belong to the family of Reoviridae. It causes…

Q: What are the primary and the secondary constrictions o a chromosome? What is the other name given to…

A: * primary constrictions is the centromere of chromosome and the chromatids of a chromosome attached…

Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…

A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.

Q: Are plants male female or both? EXPLAIN Please answer asap and your content should not be palgarised

A: The term "plant" refers to a diverse group of living organisms that all belong to the Plantae…

Q: Organisms that produce offspring that always look like the parents are said to be: O Purebred/Pure…

A: Organisms that produce offsprings that always look like the parents are said to be.

Q: The principal DNA polymerase in eukaryotic leading strand DNA replication is: A DNA polymerase B…

A: *  DNA polymerase catalyze the synthesis of DNA molecules from precursors of DNA which are essential…

Q: Q.8. What is recombination? Mention its applications with reference to genetic engineering.

A: When genes cross over during meiosis, recombination occurs. This is the process of creating a new…

Q: Q.4. What is an operon? Explain an inducible operon.

A: An operon is a functional unit of DNA that contains a cluster of genes that are all controlled by a…

Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer

A: INTRODUCTION Answer to the question 44 is given below.

Q: ructures commonly present in all vertebrate kidneys?

A: Vertebrates have the following variation of the kidneys: - Pronephros Mesonephros Metanephros

Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…

A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…

Q: What is Sex-linkage?

A: Introduction In this question we will discuss about the sex linkage.

Q: A lawyer sets out to prove that a child with type A blood is the son of a man with type B blood and…

A: This question is about genotype and phenotype.

Q: Sometimes, the young ones born have an extremely different set of eyes or limbs. Give a relevant…

A: Introduction We will answer the question in below step

Q: Q.2. Comment on the statement, "Migration may increase or decrease the effects of selection".

A: Introduction We will comment on the statement given in the question.

Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…

A: Rheumatic fever:A illness that can develop as a result of strep throat or scarlet fever that has…

Q: Question 26 The initial event in the conversion of an hnRNA to the mature RNA which leaves the…

A: Answer is D

Q: Question 32 What are two pros and two cons to the growth of urbanization and more people living in…

A: Urbanization is of the concerns that world faces now a days prominently. Urbanization is a process…

Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…

A: * Skeleton is the framework of  human body which is composed of 270 bones at birth and can be…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…

A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…

Q: Consider the following image - the dotted lines represent hydrogen bonds between nitrogenous bases:…

A: There are two different type of nucleic acids and these are DNA and RNA. Four different types of…

Q: Question 16 In base-excision repair, the first enzyme in the sequence is, _ creating a(n) _ site. (A…

A: INTRODUCTION Base excision repair This is a cellular mechanism that repairs damaged DNA.

Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…

A: Brain senses the changes in the blood glucose levels but the information is processed by the PNS and…

Q: Question 29 Expression of genes independently of regulation is termed: A constitutive expression. (B…

A: Ans 29  - the correct answer of the above question is B) AUTOREGULATION. Expression of genes…

Q: Question 28 The Canada Health Act specifies five main principles: Public administration,…

A: Canada Health Act expects that the regions and domains broaden medicinally important emergency…

Q: Explain why chytrids are considered an ancient fungal group.

A: Microscopic organisms are referred to as microorganisms. Bacteria, archaea, protozoa, algae, fungi,…

Q: Which of the following statements is true when considering this figure? It represents natural…

A: ANSWER) (f) all of the above are true. The bottle full of marble and and the jar represents the…

Q: As a young girl, Maria suffered a head injury that damaged her pituitary. An injury to the pituitary…

A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…

Q: Chapter 23- Diseases of the Digestive System Match the description on the left side to the correct…

A: INTRODUCTION Answer to the question 41-50 is given below.

Q: The Earth’s atmosphere consists of 78% nitrogen. Why do you think that plants and animals can’t use…

A: Earth’s atmosphere contains a huge amount of nitrogen gas. But this nitrogen is unavailable to…

Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…

A: A great number of diseases are caused due to multiple problems. And hypocomplementemia is such…

Q: Rice Malze Wheat Millet Sorghum 05 cereal crops provide 60% of the food energy taken in by the…

A: Cereal  Cereals are the kind of grass that are cultivated for their grains.

Q: The fossil Neanderthal bones from Shanidar Cave were surprising because they showed that…

A: *Neanderthals are subspecies of archaic humans of Eurasia about 40,000 years ago. factors like small…

Q: Match the description on the left side to the correct term from the choices on the right side.…

A: The living world comprises of the plants, the animals and the microorganisms which we cannot see…

Q: Which factor is not required for natural selection to occur?

A: This question is based on evolution and natural selection.

Q: Q.1. Enumerate the key concepts in the evolution theory of Darwin.

A: The two most important concepts in Darwin's theory of evolution are as follows:

Q: Like nucleotides, amino acids have directionality in their back bone. While nucleic acids are…

A: Central dogma The process of translation of DNA into gene products is called the central dogma. It…

Q: . Which of the following is mismatched? a) Increased UVC radiation — CFCs b) Acid rain — nuclear…

A: Introduction Fully or partially halogenated hydrocarbons containing carbon, hydrogen, chlorine, and…

Q: Based on Figure 17-35, write a sentence stating howtranslocation can lead to cancer. Can you think…

A: Translocations were discovered cytologically for the first time in the late nineteenth and early…

Q: Match the description on the left side to the correct term from the choices on the right side.…

A: 51. -->   option M. 52.  -->  option B. 53. -->    option L. 54. -->   option J and K…

Q: Describe the structure of multicelled fungi.

A: Introduction Fungi are a kingdom of generally multicellular eukaryotic creatures that are…

Q: Define the words phylogeny, phylogenetic tree and systematics

A:

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: In Figure 17-28, what would be the consequence of acrossover between the centromere and locus A?

A: The exchange of chromosomal segments between nonsister chromatids in meiosis is known as crossing…

Q: What is psedupodia

A: Introduction :- A pseudopodium is a transient protrusion of a eukaryotic cell's cytoplasm.

Q: short eared mutant male rabbit was crossed with normal long eared doe rabbits and 29 long eared and…

A: This is a type of monohybrid cross because only one character is involved. Dominant character can…

Q: Which of the following is true about neglected tropical diseases? Group of answer choices Though…

A: * Neglected Trophical disesase commonly seen  in countries like Africa and Asia and Latin America…

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.