The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly variable. B Eukaryotes have multiple RNA polymerases. c) They can function as ribozyme. D RNA can contain modified bases.

The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly variable. B Eukaryotes have multiple RNA polymerases. c) They can function as ribozyme. D RNA can contain modified bases.

Name: Question 35The fact that some eukaryotic FRNAS are self-splicing indi
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Question 35The fact that some eukaryotic FRNAS are self-splicing indicates thatA RNA structures are highly variable.B Eukaryotes have multiple RNA polymerases.c) They can function as ribozyme.RNA can contain modified bases.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 21CTQ: A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is...

See similar textbooks

Similar questions

Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?
Explain how the miR-200 family of miRNAs behave as tumorsuppressorgenes. What happens when their expression is blocked or decreased?
In vitro translation systems have been developed inwhich specific RNA molecules can be added to a testtube containing a bacterial cell extract that includes allthe components needed for translation (ribosomes,tRNAs, amino acids). If a radioactively labeled aminoacid is included, any protein translated from that RNAcan be detected and displayed on a gel. If a eukaryoticmRNA is added to the test tube, would radioactive protein be produced? Explain.
Each transfer RNA requires at least four specific recognition sitesthat must be inherent in its tertiary protein structure in order forit to carry out its role. What are these sites?
A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
Yet another class of suppressor mutations not described in the chapter are mutations in tRNA genesthat can suppress frameshift mutations. What wouldhave to be true about a tRNA that could suppress aframeshift mutation involving the insertion of a singlebase pair?
An RNA sequece includes 15 codons. How amny animo acids does this sequence encode?
Experiment The consequence of a point mutation in a human tRNAMe gene was studied in this experiment. Plasmids carrying either the wild-type tRNA Me transcription unit or the mutant gene were microinjected into Xenopus laevis oocytes together with [a-3 PIGIP. The oocytes were incubated for 5 hours, and then RNA was extracted from whole oocytes, separated nuclei, or cytoplasm. RNA samples were subjected to polyacrylamide gel electrophoresis and autoradiography
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
Some prion-related diseases, such as familial fatal insomnia, areinherited. How would you expect the mutation has altered the PrPgene in this case? Would it have affected the promoter, the regulatorysequences, or the coding sequence of the PrP gene?
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?