Q: How many genes are in the human genome?
A: Genome of human is a complete set of "nucleic acid sequences" encoded as DNA present within the 23…
Q: How are polymorphisms different than mutations?
A: The variation in the deoxyribonucleic acid are described by mutations and polymorphisms. A mutation…
Q: What is the difference between X and y chromosomes and how to they effect genetics?
A: X and Y chromosomes serve as the basis for sexual differentiation. They are primarily the sex…
Q: 1. What are ethical issues related with GMOS? Do you think human cloning should be allowed or should…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: Explain why you cannot always apply this statement in genetics: “What you see is what you get.”
A: Genetics is a discipline of biology that studies genes, genetic diversity, and heredity in living…
Q: 1. What is the importance of Gregor Mendel's Law of Inheritance in Molecular Biology?
A: MENDEL'S LAW OF INHERITANCE IN MOLECULAR BIOLOGY INHERITANCE : It is defined as the process of…
Q: 1) explain how differences in gene expression of genetically similar organism can result in…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What are DNA polymorphisms?
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: What makes the science of genetics important?
A: Definition: Genetics is nothing but the study of heredity which involves the study of genes, genetic…
Q: What is a different version of a gene called?
A: Gene is the smallest component of genetic material. It contains codons which code for specific…
Q: 1. Distinguish between phenotypes and Genotypes. 2. Differentiate genetic traits from observed…
A: Genotype and Phenotype are terms used in genetics. Genotype Phenotype 1. It is the genetic…
Q: What is DNA polymorphism?
A: DNA, the genetic material is the hereditary substance in the cell. It carries all information…
Q: 7. discuss the role environment plays on phenotypes
A: Phenotype is a set of characteristic traits in a organism, this includes appearance, behavior, color…
Q: 5)Would you expect mutations to always produce recessive traits? Why or why not?
A: Mutations are sudden inheritable variations that occur in an organism's genetic material due to…
Q: 1. What is an allele? 2. What is a point mutation? 3. How are point mutations related to alleles?…
A: Note: I have answered These questions based on my knowledge, we are not supposed to answer questions…
Q: How can differences in DNA from individuals be seen?
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Q: How Mutation Creates New Alleles in a Gene Pool ?
A: The biochemical substances that are carried from the preceding to the succeeding generation are the…
Q: How does genetic change occur?
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: 5. What is the difference between an allele and a locus? 6. Why do forensic labs analyze non-coding…
A: The DNA sample from the crime scene can be amplified, or copied in large numbers using a technique…
Q: 9. (a) A child has a rare recessive disease due to a mutation in Gene X; both his parents are…
A: Humans have two types of chromosomes, autosomes and allosomes or sex chromosomes. There are 22 pairs…
Q: 15) A company provides genetic analysis to people who want to learn more about their ancestors. One…
A: The offsprings are produced as a result of sexual reproduction in case of human because there are…
Q: 1. Fruit Flies and Genetics Research: Imagine you are working in a genetics lab with the fruit fly…
A: Introduction The relationship between two versions of a gene is referred to as dominant. Individuals…
Q: What is an imprinted gene? Explain 2 sentenc
A: In genomic imprinting, the ability of a gene to be expressed depends upon the sex of the parent who…
Q: Describe how a cross between two closely related organisms may result in genetic problems.
A: Cross or Mating in between closely related organisms is called as inbreeding. This type of breeding…
Q: Mendel formulated the Law of Inheritance in his pea plant experiment
A:
Q: genetically modified organism
A: Genetically modified organism or GMO: These are the organisms with superior characters made with…
Q: What is genetic selection?
A: Gene is a segment of DNA (deoxyribonucleic acid) of an individual that is responsible for the…
Q: How do mutations affect genotype and phenotype?
A: The term mutation is defined as any type of change in deoxyribonucleic acid (DNA). It can be caused…
Q: 1A. Fruit Flies and Genetics Research: Imagine you are working in a genetics lab with the fruit fly…
A: Note- Since you have asked multiple question, we will solve the first question for you. If youwant…
Q: What is genetic polymorphism? What is the source of genetic variation?
A: A sequence variant that has a population frequency of at least 1% is known as polymorphism.
Q: What do you want to learn, if anything, about your own genome? (Explain Clearly
A: to learn more about the genome the human genome project was established which tell in detail about…
Q: 1. Which is more important, nature or nurture? 2. All genetic characteristics are not inherited.…
A: 1) Nature is more important than nurture, because gene determines the characteristics of human…
Q: 3. How do different types of traits differ in how quickly they respond and how easily they can be…
A: Traits are determined by genes, and also they are determined by the interaction with the environment…
Q: 1) Janet and her family members have attached earlobes (recessive trait). However, her maternal…
A: Genetic Traits --The characters that are encoded DNA are called genetic traits . Mendal 'S law of…
Q: 1. Read on history of genetics. Choose 6 persons who you consider had contributed most importantly…
A: Genetics: Genetics is a branch of biology that studies genes, genetic diversity, and heredity in…
Q: ***18. Complete this flowchart to show how different alleles can result in different characteristics…
A: Genotype can be outlined as the combination of alleles that together form gene. This combination of…
Q: Discuss the basic structure and function of DNA as the genetic material.
A: Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the…
Q: About how many variations exist in your DNA that does not exist in your parents’ genome?
A: Recombination is a process by which a diverse genome is created with bits of DNA from ancestors to…
Q: 1. What is a phenotype? 2. What is a genotype? 3. Alleles always come in 4. What is homozygous? 5.…
A: Phenotype refers to the set of observable characteristics of an individual resulting from the…
Q: How many genes do humans have?
A:
Q: ***18. Complete this flowchart to show how different alleles can result in different…
A: Alleles are forms of the same gene with small differences in their sequence of DNA bases. These…
Q: How are brothers and sisters genetically unique?
A: We are also 50% genetically related to our sisters and brothers.
Q: 1. What are chromosomes and where are they located? 2. How many chromosome do humans have? How are…
A: The genetic material of eukaryotic organisms is highly compressed structures. These are bound with…
Q: What is polymorphism? Outside of genes (non-gene regions of genome) what are the 4 types of…
A: The word polymorphism refers to having many forms.
Q: 1. Suppose you identify a new gene in mice. One of its alleles specifies white fur, another…
A: Since we only answer up to 1 question in case of multiple question, we’ll answer the first question…
Q: 4. How can the different gene interactions be differentiated from each other and from the Mendelian…
A: Answer:- Mendelian inheritance refers to the expression of monogenic traits, i.e. gene expression is…
Q: 1. How could scientists use this transgenic line of zebrafish to distinguish environmental versus…
A: Zebrafish is a freshwater fish mostly found in South Africa. The special distinguishing feature…
Q: protein-coding gene
A: Transcription is defined as the process of copying a segment of DNA into RNA. Translation is defined…
Q: What does it mean for a gene to be polymorphism and what is a polymorphism in DNA?
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: What is the study that deals with the genes called?
A: Introduction: Every human has 23 pairs of chromosomes. Out of these, 22 pairs are autosomes and 1…
A mutation is a sudden heritable change in DNA sequence which corresponds to an altered amino acid sequence and can lead to faulty or nonfunctional protein. Mutations are responsible for most genetic diseases.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?How large is the human genome?What would be the order of genes?
- What is the difference between a gene and an allele? a. A gene is a form of a trait, and alleles make up genes. b. A gene is a sequence of bases in a DNA molecule, and an allele is an alternative version of a gene that codes for the same feature. c. A gene is a sequence of bases in a DNA molecule, and an allele is an alternative version of a gene that codes for a different, but related, feature. d. A gene describes a chromosome, and an allele describes an exact location of a gene on a chromosome. e. An allele and a gene are the same thing.If you were to choose between a fruit fly and a mouse for an experimental organism in genetics, which would you choose? List down five reasons for your answer.a. Which gene is mutated in individuals with sickle-cell anemia? b. What are the major symptoms of this disorder? c. What was the first published scientific description of sickle-cell anemia? d. Describe two other features of this disorder that you learned from the OMIM database and state where in the database you found this information