1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. . When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this?

1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. . When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides? What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes? What type of mutation is present in the mutant hemoglobin gene?
You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides?
TRUE or FALSE a) The deoxyribose connects to N9 of guanine. b) In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of this arrangement, the molecule is 2nm wide along its entire length. Example is A with G or C with T.
This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
True or False 1. In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of this arrangement, the molecule is 2nm wide along its entire length. Example is A with G or C with T.
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)