You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides? What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes? What type of mutation is present in the mutant hemoglobin gene?

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X…

A: The High-Frequency Recombination Strains(Hfr)- When the F+ chromosome combines with F plasmid . It…

Q: As part of a project investigating potential new drug targets in the fight against malaria, you are…

A: Introduction:-  Truncation of protein:- is meant by the proteolysis or structural gene manipulation…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of…

A: DNA sequences are transcribed into mRNA sequence, which acts as codons for the amino acid sequence.…

Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…

A: The proteins are produced by the amino acids that are produced by the translation process. During…

Q: Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown…

A: INTRODUCTION Single nucleotide polymorphism Single nucleotide polymorphism is the single nucleotide…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each…

A: Supercoiling of deoxyribonucleic acid (DNA) is the under or overwinding of DNA strands. Supercoiling…

Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…

A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…

Q: If circular B-DNA is positively supercoiled, will these supercoils be left- or right-handed?

A: Supercoiling of DNA is a biological process that regulated the unwinding and rewinding of the DNA…

Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…

A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…

Q: A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence:…

A: When a single base nucleotide is changed, it is called as point mutation.  Non sense mutation, is a…

Q: α-thalassemia is another blood disorder in which abnormal hemoglobin molecules are formed, leading…

A: A )    Hemoglobin Wayne is an alpha chain variation which shows itself as two minor hemoglobin (Hb)…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…

Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…

A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…

Q: Some viruses, such as SV40, contain closed circular DNAS carrying nucle- osomes. If the SV40 viral…

A: Histone protein is an octameric, made up of positively charged amino acid around that negatively…

Q: ckle cell anemia is a hereditary disease in which a faulty hemoglobin (Hb S) molecule is produced. A…

A: Hemoglobin is an iron-containing protein present in the red blood cells (RBCs). It transports oxygen…

Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: Why is gene duplication within globin genes beneficial?

A:

Q: that the

A: Polypeptides, or proteins, are chemical compounds composed up of amino acids. They're big,…

Q: . The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age…

A: Amyotrophic lateral sclerosis (ALS) is a paralyzing neurodegenerative disease which is usually fatal…

Q: What is the principle behind the very specific sequence in donning and doffing PPEs? Explain

A: PPE -- refers to the personal protective equipments which help against the spread of infection and…

Q: SspI --- 5' AAT - ATT 3' 5' GGATAATATT GTTAACAATCTCTACGGGTTAACACCCTTGGAATATTTTAA 3' 3'…

A: DNA is one of the two nucleic acids made up of monomer units of nucleotides. DNA nucleotides are…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…

A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…

Q: If the MJ helix in bacteriophage MS-2 is replaced with all Adenines on both strands, what would you…

A: A bacteriophage is a virus that is able to infect bacteria. Bacteriophage literally means "bacteria…

Q: Each of the following pairs of primers has a problem with it. Tell why the primers would not work…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…

A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.

Q: The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive sulfur…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: HpaI --- 5' GTT - AAC 3' 5' GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3' 3'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Some viruses, such as SV40, contain closed circular DNAs carrying nucleosomes. If the SV40 viral…

A: As we know that viral chromosome is circular in a structure having supercoiled DNA. This…

Q: Why might the locations of introns and exons be the same in both alpha- and beta-hemoglobin genes?

A: A phenomenon known as gene duplication arises due to 'unequal cossing over'. Due to unequal crossing…

Q: Which of the given disorder can be seen in an individual when the mutation includes substitution of…

A: Purines and pyrimidines are nitrogenous bases present in nucleic acids. Substitution of purine by…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: If a gene is made up of 26% Adenine, then how much of it is Cytosine?

A: Answer: DNA : Deoxyribonucleic acid which acts as the genetic material, it composed of four nucleic…

Q: The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to…

A: Transcription is the molecular process of synthesis of RNA from DNA. The genetic code of DNA is…

Q: plz explain with thorough explanation

A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…

Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…

A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…

Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?

A: Gene is a stretch of DNA that codes for a particular polypeptide chain.

Q: 5'-ATGTCCACTGCGGTCCTGGAAAACCCAGGC-3’ wild-type allele 3'-TACAGGTGACGCCAGGACCTTTTGGGTCCG-5’…

A: The term mutation refers to the alternations in DNA sequences. The chemicals or other substances…

Q: How can a single nucleotide insertion in the beta globin gene generate a phenotypic change in the…

A: Thanks For Your Question. INTRODUCTION: Hemoglobin present in the RBC help in Oxygen transport from…

Q: The human genome contains thousands of sequences known as small open reading frames, some of which…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: Contrast the contributions of Pauling and Ingram to our understanding of the genetic basis for…

A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Need to find the complementary strand for the given strand.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.