Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 19, Problem 1ITD
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicity’s sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options.
Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein.
Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure.
Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins.
Protein sequences are expected to evolve and…
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?
Below is a sequence of DNA.
5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3'
How many "reading frames" can be identified for this sequence?
How many "open reading frames" can be identified for this sequence?
What is the frame of the longest ORF?
Chapter 19 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 19.1 - What additional biological questions can be...Ch. 19.2 - What is the principle behind whole-genome shotgun...Ch. 19.2 - Prob. 2SBCh. 19.2 - Prob. 3SBCh. 19.2 - Prob. 4SBCh. 19.3 - Prob. 1SBCh. 19.3 - Prob. 2SBCh. 19.3 - Prob. 3SBCh. 19.4 - Prob. 1SBCh. 19.4 - Prob. 2SB
Ch. 19 - Prob. 1TYKCh. 19 - How do pseudogenes differ from genes? a. They are...Ch. 19 - Prob. 3TYKCh. 19 - Prob. 4TYKCh. 19 - Prob. 5TYKCh. 19 - Prob. 6TYKCh. 19 - About 95% of the average human transcription unit...Ch. 19 - Prob. 8TYKCh. 19 - Prob. 9TYKCh. 19 - When two protein-coding genes have very similar...Ch. 19 - Prob. 11TYKCh. 19 - Prob. 12TYKCh. 19 - Prob. 13TYKCh. 19 - Discuss Concepts The genome of the yeast...Ch. 19 - Prob. 15TYKCh. 19 - Prob. 16TYKCh. 19 - Prob. 17TYKCh. 19 - Below is a sequence of 540 bases from a genome....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?arrow_forwardin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forward
- If you know the sequence of amino acids in a protein, what does the genetic code table allow you to infer about the sequence of base pairs in the gene that specifies that protein?arrow_forwardYour advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…arrow_forward
- Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?arrow_forwardAssuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides have on the reading frame? The addition or loss of three, six, or nine nucleotides?arrow_forwardIn reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?arrow_forward
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?arrow_forwardWhich of the following RNA sequences is an inverted repeat and can form a stem-loop structure? What is the correct option from the choices below? GGUAGGCAUUACGGAUGG GGUAGGCAUUAGCCUACC GAGAGAGAUUAGAGAGAG GGGGGGGAUUAGGGGGGG GAGAGUGUAAGUGUGAGAarrow_forwardLet’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License