1.What would you predict would happen if you added Anti-A serum to this type of blood? 2. What would you predict would happen if you added Anti-B serum to this type of blood?3. Why is the genotype that codes for this blood type considered “codominant”?Please answer all of them now and do it
Q: You have an adult patient who is exhibiting persistent and severe infections caused by opportunistic…
A: Without a doubt! To better understand the diagnostic workup and treatment options available to a…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…
Q: Essay about Papua Pew Guineas unique biodiversity and rich ecosystems
A: The objective of this question is to provide an in-depth understanding of the unique biodiversity…
Q: der these chemical species by increasing pH of an 0.1 M aqueous solution of each. That is, imagine…
A: Step 1: Step 2: I have given detailed step by step solution approach to solve this problem go…
Q: cardiac output drops, then A and B • A and C Blood flow must decrease Blood flow must increase The…
A: The objective of the question is to understand the physiological changes that occur when cardiac…
Q: Replication Methods and Central Dogma1. Information about replication2. What happens at each step
A: DNA replication is a crucial process in biology, essential for the accurate transmission of genetic…
Q: Proto-oncogenes can change into oncogenes that cause cancer. Which of the following best explains…
A: Cancer is caused by abnormal cell growth causing the formation of tumors. Tumor is a mass of cells…
Q: The Belgian anatomist and physician Andreas Vesalius, in his textbook entitled De Humani Corporis…
A: Andreas Vesalius disagreed with Galen that right/left ventricles blood could flow directly. Vesalius…
Q: Whisker number in a new breed of mouse is controlled by 2 genes. The line with no contributing…
A: When crossing an AaBb mouse with an AaBB mouse, the offspring can have four different genotypes:…
Q: When Mendel crossed yellow-seeded and green-seeded pea plants, all the offspring were yellow-seeded.…
A: The allele for yellow seeds should be written in uppercase letters, while the one for green seeds…
Q: Learning Task # 2. Punnett Square a. Given the cross AaBb X AaBb, construct a Punnett square and…
A: AABB (homozygous dominant for both traits): 1 part out of 16 total partsAABb (homozygous dominant…
Q: Please answer both thank you!
A: 11)Answer:Centrifuges are workhorses in blood analysis, utilizing the principles of circular motion…
Q: What is the significance of the complementarity of the two strands of DNA? It prevents mutations…
A: The question is asking about the importance of the complementarity of the two strands of DNA.…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx You will need to access the journal website…
A: A randomized experiment was conducted to investigate the effects of early physical exercise therapy…
Q: answer both 5 and g i also got an answer for 5 which is…
A: The genetic code is the system by which the nucleotide sequence of DNA is translated into the amino…
Q: Show the cross between a pure breeding dominant tall pea plant and a short plant in a punnet square
A: Pure-breeding means a homozygous genotype i.e. both the alleles present in the genotype of an…
Q: Students filled three identical flasks with water and placed elodea, a type of aquatic plant, in…
A: Explanation:The presence of dissolved oxygen in water is closely related to the process of…
Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .
A: In cells, different parts have specific jobs in making and controlling proteins. One important part…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: The objective of this question is to calculate the total number of cells in the culture medium using…
Q: 18
A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…
Q: Zollinger-Ellison syndrome is a peptic ulcer disease characterized by overproduction of gastric…
A: Approach to solving the Question(s):To answer the question about the two types of stomach cells…
Q: How does light pollution negatively impact sea turtles / the aspect of human health? Explain.
A: Approach to solving the question:Light pollution disrupts a vital navigation system for sea turtle…
Q: Impedance technology is based on the fact that blood cells increase electrical conductivity in…
A: The objective of the question is to determine the validity of the statement: 'Impedance technology…
Q: Mark the following statements as true or false. If a statement is false, correct it to make a true…
A: In cellular metabolism, a series of chemical reactions happen, numerous of which include the…
Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…
A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…
Q: Do the cells migrate to new locations during development and form selective adhesions with other…
A: Amid the early stages of development, cells alter a lot. They not only do diverse things, but also…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: When sterile compounding, which of the following are considered critical points (Select all that…
A: In sterile compounding, maintaining sterility is paramount to ensure the safety and efficacy of the…
Q: Based on this tree, fill in the table below it, using 1 to indicate the presence of a trait and 0 to…
A: In the table provided, each row represents a trait (A, B, C, D, E), and each column represents a…
Q: a diagram that shows evolutionary connections between clades is called a_______ . a. karyotype c.…
A: Understanding the links and divergences between different species or groups over time is fundamental…
Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…
A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…
Q: What does it mean that an allele increases an organism's fitness? Choose one of the following: it…
A: Alleles: These are different forms of a gene. Organisms inherit alleles from their parents, and…
Q: Which of the three phylogenetic trees of the Drosophila species is different from the other two? a.…
A: Approach to solving the question:Carefully observe the 3 trees and find which is different Detailed…
Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…
A:
Q: Stark law (Physician Self-Referral Law) Summarize the law or regulation above. Describe the entity…
A: Here's a detailed breakdown of how I approached solving the questions regarding Stark Law, including…
Q: Which of the following metabolic tests would only be performed on Gram-positive bacillus? VP TSIA…
A: The objective of the question is to identify which among the given metabolic tests is specifically…
Q: Out of the three, what would be an example of evolution? A population of green beetles changes over…
A: The objective of the question is to identify which of the given scenarios is an example of…
Q: Rouleaux is characteristic of which clinical condition? Question 4 options:…
A: The objective of the question is to identify the clinical condition that is characterized by the…
Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…
A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…
Q: consequences of not managing water
A: Key references:…
Q: Why might it be advisable for an Rh–woman who has had an abortion, miscarriage, or an ectopic…
A: The Rh factor is something on red blood cells. A few individuals have it (called Rh+) and a few…
Q: A family with a history of a genetic disorder were analyzed with a dot blot using a probe for both…
A:
Q: Which of the following mutations cannot be inherited by a person's biological children? A mutation…
A: The objective of the question is to identify which type of mutation cannot be passed on to a…
Q: If a DNA strand has the sequence AGCATC, what will be the sequence on the complementary strand?
A: Sure, let's break it down step by step:1. The given DNA sequence is AGCATC.2. According to the base…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: Culture medium is generally referred to as "medium". It is a nutrient-rich solution used to support…
Q: A original pedigree: 8 alleles 3 78 13 1 2 12 34 34 5 6 23 56 7 8 9 10 11 12 37 17 26 25 36 35 Using…
A: We search for situations in which a child has a combination of alleles that could not have been…
Q: hat are orthologs ?
A: Orthologs are genes in particular species that separated from a common predecessor gene due to…
Q: 16) Bacterial DNA replication is said to be: a) Linear b) curvilinear c) circular d) exponential e)…
A: 16) Bacterial DNA replication is said to be circular. This is because bacterial DNA is organized in…
Q: Can u give me the correct answer
A: Solution: (information required was not provided. One possible food web is provided in the image…
1.What would you predict would happen if you added Anti-A serum to this type of blood?
2. What would you predict would happen if you added Anti-B serum to this type of blood?
3. Why is the genotype that codes for this blood type considered “codominant”?
Please answer all of them now and do it
Step by step
Solved in 2 steps
- 1. A mother with blood type A has a child with blood type O, and she claims that Mister X is the father. Mister X denies that he could possibly be the father, because he has blood type B. If you were the judge presiding over this case, which of the following arguments would you find most convincing? a. Mr. X could be the father if his blood genotype is IBIB, and the mother’s blood genotype is IAIA b. Mr. X cannot be the father because a child with blood type O cannot have a parent with blood type B c. Mr. X could be the father if his blood genotype is IBi, and the mother’s blood genotype is IAi d. Mr. X cannot be the father because a parent with blood type B cannot have a child with blood type O e. Mr. X cannot be the father because the human ABO blood types are sex-linked traits 2. A monohybrid cross between two pea plants producing yellow peas, resulting in an F1 phenotypic ratio of 3:1 (three yellow pea plants to one green pea plant) indicates what about the parental pea plants?…16.A couple is suspecting that their baby was switched at the hospital. The mother has blood type A, the father has blood type B, and the baby has blood type O. Which among the following conditions would prove that the baby is switched? A. Mother’s genotype: IAIA & Father’s genotype: ii B. Mother’s genotype: ii & Father’s genotype: IBIB C. Mother’s genotype: IAIA & Father’s genotype: IBIB D. Mother’s genotype: IAi & Father’s genotype: IBi1. Suppose that the three samples are from two parents and their child. Which individuals are the parents? Which individual is the child? How do you know? Parent 1 = Parents 2 = Child = 2. What genotype must each individual have for this scenario to be possible? Parent 1 = Parent 2 = Child = please answer all of them now.
- 4. Marfan syndrome is a genetic trait caused by in a dominant allele. The trait causes a weakening of the aorta that can be fatal. A teenager whose mother has the syndrome (but whose maternal grandfather was not affected), and whose father was unaffected, is concerend that she may have the trait. a. What is the phenotype of each of her parents? Genotype? b. What is the chance that the teenager has Marfan syndrome?3. Hemophilia is a sex linked trait that does not allow for blood clotting normally. It is a recessive genetic defect. In the royal family, the mother of the Prince is a carrier for hemophilia. (XHXh) while the father is normal. ( XHY) . What is the genotype of the Prince if he carries the bleeder’s disease? What is the probability that all the female princesses are normal? Use the Punnett square to show your solution.1. A woman who is heterozygous for hemophilia marries a man with hemophilia. What are the genotypes and phenotypes of the children? a) What is the genotypic ratio of the above cross (Write number next to genotype)? ___________________________________________________________________ b) What is the phenotypic ratio of the above cross? (Write number next to phenotype)? ___________________________________________________________________
- Figure 13.4 Which of the following statements is true? Recombination of the body color and red/ cinnabar eye alleles will occur more frequently than recombination of the alleles for wing length and aristae length. Recombination of the body color and aristae length alleles will occur more frequently than recombination of red/brown eye alleles and the aristae length alleles. Recombination of the gray/black body color and long/short aristae alleles will not occur. Recombination of the red/brown eye and long/short aristae alleles will occur more frequently than recombination of the alleles for wing length and body color.2. A woman of blood group AB marries a man of blood group A whose father was a group O. What is the probability that: a. their child will be group A? b. their child will be group B? c. one child will be group A and the other group O? d. the first child will be a girl with type AB?4. Mr. Salazar has Type A blood while Mrs. Salazar has Type B. They have four children. Bobbie has Type A, Gabbie has Type B, Alex has Type AB, and Teddie has Type O. What are the genotypes of all six people in this family? NOTE: The ABO blood type gene has three alleles. IA and IB are codominant; i (for Type O) is recessive to both.
- A girl is taking a genetics course on the ABO blood types where she learns that she has an O blood type. She realizes that this is strange because her father has an AB blood type. She knows that infidelity and adoption are not possible. How could her O blood type be explained?5.) A man and a woman living in a tropical area where malaria is prevalent and health care is not accessible have seven children during their lifetime. The genotypes of their children are: ss, Ss, SS, ss, Ss, Ss, and SS. What must the genotypes of both parents be? Your answer should include a Punnett square to illustrate your work, and list all the genotypes and phenotypes.1. The first genetic test used a short DNA sequence that was closely linked to the Huntington’s locus. People taking the test were classified as to whether they had the DNA sequence that was linked to the Huntington’s disease. This method was 95% accurate. This means that 95% of the people who had the Huntington’s-linked DNA sequence actually inherited the Huntington allele. It also meant that 95% of the people who did not have the DNA sequence linked to the Huntington allele did not inherited the wild-type allele (not the Huntington allele).Why might this preliminary test not be as accurate as a gene test for the actual Huntington’s allele? Explain.