A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion

A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutation
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through c. For Mutant 1: Met-Ser-Pro 1) indicate what change has occurred at the DNA leve! 2) identify the specific type of mutation that occurred in the DNA (single base substitution, frameshift (insertion, deletion), 3) indicate the phenotypic effect of the mutation (nonsense, etc.). Show all work.
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your research team. You have identified a new alternate allele of the sequence 5' AUG AAG CAG GGA UAA 3'. What type of mutation does this alternate sequence illustrate?
Based on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGG
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A mutation occurs in the gene. The mutant protein has the following amino acid sequence: Met-Trp-His-Ser-Ala-Ser-Phe An intragenic suppressor mutation restores the amino acid sequence to that of the original protein: Met-Trp-His-Arg-Ala-Ser-Phe Give at least one example of base changes that could produce the original mutation and the intragenic suppressor. (Consult the genetic code in Figure 15.10.)