10 0.9 0.8 8- 0.7 0.6 0.5- 0.4 5- 4- 3 2 0.3 0.2 0.1 01 234 S 6 7 8 9 10 Size of individual offspring 01234 5 6 7 8 9 10 Size of individual offspring Based on the graphs above, what is the parental fitness for a bird that lays three (3) eggs? Number of offspring Survival probability for individual offspring

Q: 9.Which among the following choices lists the three phases of the ovarian cycle in the correct…

A: Ovarian cycle is a series of events that happens during a period, which contains the follicle…

Q: Some traits that can be counted and expressed in whole numbers, such as bristle number in…

A: Introduction Traits are features or attributes of an organism that are influenced by the environment…

Q: How are Ca2+ channels involved in phototransduction? they cause neurotransmitter release even if no…

A: Introduction The sensory transduction of the visual system is called visual phototransduction. It is…

Q: Briefly describe the effector functions of the following subsets of CD4* helper T lymphocytes and…

A: Helper T cells are arguably the most important cells in adaptive immunity, as they are required for…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: Learning Outcomes: 1. Prepare IM injection correctly recalling 5 rights of medication. 2. Develop a…

A: Introduction Nasogastric intubation is a medical procedure in which a plastic tube is inserted via…

Q: transmission electron micrographs during viral infection cycles of both in vitro and in vivo…

A: Electron micrographs are obtained with the help of electron transmission microscope. It helps in the…

Q: Which of the following is an example of ecological competition? A. A cheetah chases and kills a…

A: an ecological niche is an area used or inhabited by species that have adapted especially for it. For…

Q: Don't copy from internet. Thanks!! 1. When does the food chain starts? How come it never exceeds…

A: Food chain refers to the sequence of events in an ecosystem where one living organisms eats other…

Q: The bony wall found at the end of the middle ear has O the three ossicles: malleus, incus and stapes…

A: As per our honor code, we are allowed to answer one question at a time. You have posted multiple…

Q: What bond and molecule store and provide energy to perform work?

A: ATP ( Adenosine 5'- triphosphate  ) provides energy by transferring a phosphate group to another…

Q: indicate if TRUE or FALSE 1.  Cactus is an inhibitory protein.

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: Which of these fundamental concepts is well illustrated by genetic exchange among, but distinct…

A: Evolution is the change in the specific features of a species over several generations and depends…

Q: Which of the following factors in today’s world make it dif-ficult to keep disease-causing…

A: Diseases can be infectious diseases, hereditary diseases, deficiency diseases, and physiological…

Q: Explain how Lateral Flow Devices areee used to detect human chorionic gonadotropin.

A:

Q: The table below summarizes the results for Sudan IV test. Which solvent the lipid samples are…

A: homogeneous solution   Hexane Ethyl acetate Water Methanol Coconut oil…

Q: What are factors that can affect the donnan equilibrium?

A: When a liquid of an electrolyte having two diffusible ions is divided by a barrier from some other…

Q: Propose a synthesis for the compound below from benzene. Please add explanation of the steps.

A: Benzene is a cyclic organic compound that helps in several processes and necessary stuff. It is also…

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: How many sets of human chromosomes are in each of the following cell types? a. an oogonium b. a…

A: The haploid (n) number of chromosome in an organism is known as a single chromosome set. As humans…

Q: In your own words, describe the goals of industrialecology.

A: Ecology is the study of inter relationships and interactions between nature and the living…

Q: A ВЕ 1. saturation of blood and tissues with dissolved gases 2. decompression B. Oxygen starvation…

A: Option C

Q: Why is amyloid toxic to cellsand how does it contribute toneurodegenerative diseases such…

A: Pathogenic amyloids formation takes place, when healthy proteins lose their normal structure…

Q: 13.Which of the following statements is TRUE about corpus luteum?(This is a multiple choice question…

A: Answer--

Q: . The Deepwater Horizon oil spill ______ the wildlife in the Grand Bay Estuarine Research Reserve.

A: The nation watched in horror in 2010 as the BP Deepwater Horizon oil leak in the Gulf of Mexico…

Q: Edward Jenner, in eighteenth-century England, first inject-ed a child with a totally untested…

A: Edward Jenner was the first one who discovered a vaccine. He discovered the world's first vaccine…

Q: Name four differences between the structure of DNA and RNA.

A: Introduction :- Ribonucleic acid (RNA) is a nucleic acid found in all living cells that is…

Q: In outline form discuss the steps of Ziehl-Neelsen staining

A: DISCLAIMER Since you have asked multiple questions, we will solve the first question for you. If you…

Q: How, specifically, is the concept of ALLOMETRY relevant to the phylogenetic position of Homo…

A: There are few important points : Allometry : It is defined as the relationship of body size and…

Q: (a) An E. cofi DNA plasmid has 5.64 x 10 base pairs. The plasmid contains a a terminus, and…

A: Answer ::

Q: Explain how the sequence of a molecule of DNA, made up of many monomers of only four possible…

A: DNA is an organic molecule that includes genetic data as well as guidelines for protein creation. It…

Q: 2. What is the main difference between the following organisms: strep, aids, polio, measles, and…

A: INTRODUCTION Virus This is the small microscopic infectious agent which can multiply only inside a…

Q: QUESTION 44 Gluconeogenesis can be described as "glycolysis backwards" but some enzymes are replaced…

A: Gluconeogenesis  The biological process that converts non carbohydrate substrate like amino acid…

Q: Your patient has been poisoned by an unknown substance and shows signs of delirium, abnormal heart…

A: Introduction When an organism is exposed to a sufficient amount of poison, it can cause death,…

Q: Generally, polysaccha are not good antigenS, because B cells recognize thei annot get T-cell help.…

A: INTRODUCTION The immune system consists of cells that protect organisms from foreign invaders. This…

Q: Q5. Based on the data in the table below, which of the following most likely correctly identifies…

A: Nutrients are required for the proper growth and development of the organism. Some nutrients are…

Q: How many sets of human chromosomes are in each of the following cell types? a. an oogonium b. a…

A: INTRODUCTION Chromosome It is a thread like structure present inside the nucleus contains protein…

Q: Assess the following situations: a. A field planted with rice in their early vegetative stage…

A: Reproductive phase is the phase of the plant where the grains or seeds are produced after…

Q: 1. If an inherited traits displays variation in a population, then the trait is considered: 2. A…

A: Introduction Genetics:- It is the study of genes and tries to explain what they are and how they…

Q: If the parents have blood types that are both AB-, which children are likely?

A: Introduction :- Blood types are determined by the presence or absence of antibodies and inherited…

Q: Describe how lipids with hydrophilic and hydrophobic regions behave in an aqueous environment.

A: Introduction: Lipids are actually the fatty acids which are the buliding block of other lipids. They…

Q: HIGH HUMIDITY AND LOW TEMPERATURES 1. at high humidity low temperature easily transferred human 2.…

A: Humidity  The amount of water vapour present in the air is known as humidity.

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Rank these structures by the amount of DNA they include, from least (1) to most (4). + human…

A: Human mitochondrial genome contain 16569 DNA base pairs  Chromatid contain single DNA . Because…

Q: indicate if TRUE or FALSE 1. Torpedo protein is a membrane receptor 2. Binding of Gurken signals…

A: 1) Torpedo maculopathy is a circumscribed, congenital lesion of the RPE and outer retina so it's…

Q: Which of the following is NOT regulated by glucagon? Glut-4 transporters O protein kinase A O…

A: Methylation is a posttranslational alteration of proteins that modulates the function of several…

Q: A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type…

A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…

Q: How does oviposition occurs in female turtles. Provide the pathway involved in the oviposition…

A: Answer :- As we know that Males have a couple of penises that pass sperm from their cloaca to the…

Q: Draw one of the 20 amino acids and label the amino group, the carboxyl group, the R group (side…

A: Amino acids are the building blocks of proteins. The fundamental unit of life are amino acids and…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.