10 Equipment use in Expanded Programme on Immunisation

Q: Describe the ethical issues encompassing germ line gene therapy in 150 words.

A: Introduction Germline gene therapy:- In this therapy DNA is inserted into the reproductive cells…

Q: is studying a cell that has a membrane-bound nucleus and a cell wall but lacks chloroplasts. Which…

A: Depending on cellular constitution and morphology cells can be of two types eukaryotes and…

Q: Which characteristic do all prokaryotic and eukaryotic cells share? They contain a nucleus. They…

A: Prokaryotes are single-celled microscopic organisms that are divided into two distinct groups: the…

Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…

A: Adenine, guanine, cytosine and thymine are the nucleotide bases of DNA that stores genetic…

Q: Below is a Figure of an Onion Root Tip, determine which of the encircled is/are meristematic?

A: Among the encircled regions the region 1 is representing the root apical meristem.

Q: Genetic linkage leads to the production of a significantly smaller than expected number of gametes…

A: Genes that are close enough together on a chromosome "stay together," and the variants (alleles) of…

Q: Some of the biochemical reactions of GLYCOLYSIS are known to have a positive deltaG0, e.g. the…

A: The ΔG° of the reaction in the direction of glyceraldehyde 3-phosphate and dihydroxyacetone…

Q: A. Identify the following _______________ 1. The hormone that stimulates the mammary gland to…

A: Introduction :- The mammary gland is a highly evolved and specialised organ that exists in pairs on…

Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…

A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: . What is meant by a bacterial “colony” or colony-forming unit? 2. Why are colonies that develop on…

A: Since you've asked multiple questions, we're only answering the first three answers for you. If you…

Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…

A: Mutation is a permanent variation of some nucleotide sequences in an organism's genome that can…

Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…

A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…

Q: explain how signalling molecules generate gradients of other signalling molecules that mediate the…

A: Gradient generated during embryonic development by signaling molecules.

Q: Oestrogen, follicle-stimulating hormone (FSH) and luteinising hormone (LH) works together to…

A: The endocrine system collaborates with the neurological system to keep the body in a state of…

Q: What are the physical and physiological differences between an artery and a vein?

A: Artery- The blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body.…

Q: Below is a Figure of a Shoot Tip, Is the encircled part a permanent tissue? True or False

A: Permanent tissue  Tissues that attained their mature form and perform Pacific functions. They stop…

Q: Gram-negative bacteria are surrounded by two membrane bilayers separated by a space termed the…

A: Answer :  The amino acid that would be affected by the oxidising environment is cysteine and…

Q: The activity of lateral meristems_____ older roots and stems. a. lengthens b. thickens c. both a and…

A: * The answer of the question is option b that is thicken. * The activity of lateral meristems…

Q: What term describes the substance that is bound by an enzyme and converted to product? O a. Coenzyme…

A:

Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…

A: A mutagen is a substance or agent that causes DNA damage, resulting in changes to the DNA sequence.…

Q: 2. 3. What does the term symbiosis mean?

A: Introduction Ecology:- It is the study of the relationships between living organisms, including…

Q: Which of the following cells secretes the enzymes - gastric lipase and pepsin ogen? Group of answer…

A: Mucous neck cells: These basically located in gastric glands. These contain less mucin in apical…

Q: Describe the synthesis of the leading strand during DNA replication. Assume the replication bubble…

A: Watson and Crick finds that DNA is a two-stranded double helix, giving them insight into how DNA…

Q: Pyrimidines are single ringed structures which include the nitrogenous bases O guanine and adenine O…

A: Nitrogen bases These are also known as nucleobases and these are the building blocks of nucleic…

Q: For fusion of a vesicle with its target membrane tooccur, the membranes have to be brought to within…

A: Proteins are well known to define that they are used as large, complex molecules that perform…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…

A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…

Q: Which of the following are involved in photosynthesis in plants and algae? chloroplasts CO2 water

A: Photosynthesis is an important method for inbound living organisms. students and researchers…

Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.

A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…

Q: This muscle moves the eyeball upward. 1) superior rectus 2) lateral rectus 3) inferior oblique 4)…

A: The eye is a sensory organ that aids in the perception of sight or vision. The eyeball and various…

Q: here is a benign congenital condition called Hereditary Persistence of Fetal Hemoglobin (HPFH) in…

A: Hereditary Persistence of Fetal Hemoglobin is the condition when there is still fetal hemoglobin…

Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…

A: The cell is the structural and functional unit of life. It comprises of the cell membrane, cell…

Q: With only one exception, the most commonly used STR loci are spread across the human genome, each on…

A: The most common short tandem repeat (STRs) inside the human genome are dinucleotide repeats. STR…

Q: Learning Task 13-1: Diseases Caused by Mutations Disease What gene is affected by Mutation? What is…

A: A genetic disorder is a medical condition caused by one or more genetic defects. A chromosomal…

Q: Determine whether each of the following traits are the result of convergent evolution?

A: Convergent evolution is the process where distantly related organisms independently evolve from…

Q: In chymotrypsin the active site histidine Forms a tetrahedral intermediate O a. O b. Acts as a…

A: Serine protease is part of the catalytic triad and consists of the serine, aspartic acid, and…

Q: Environmental scientists David Pimentel, Rodolfo Zuniga, and Doug Morrison of Cornell University…

A: The native species are those that occur naturally in any region without any kind of interference…

Q: differentiate a nodule from a root gall? (

A:

Q: This protein adduct can hold (tether) a peripheral membrane protein to the cell membrane: A) A fatty…

A: Ionic linkages peripheral membrane protein or interactions with the polar head regions of the…

Q: Identify the true statement(s) about global temperatures across Earth's history.  (Note: may or may…

A: Given: Global temperature burden is increasing constantly around the globe. Earth's history has…

Q: Root hairs increase the surface area of the root O increase water absorption increase nutrient…

A: Water and mineral nutrients move from the soil to the upper parts of the plants through the xylem.…

Q: On a local scale, why are sowbugs commonly found in some places but not others?

A: Sowbugs and their occurrence in limited environment :-

Q: What is the fate of a protein with no sorting signal?

A: Introduction A protein is an extremely complex natural molecule made up of amino acid residues…

Q: The main difference between starch and cellulose is: O A) starch is made of fructose, while…

A: Starch Cellulose Uses about 200-1000 Glucose molecules to form one starch molecule. Take up 500…

Q: Why did Mendel self-pollinate the tall F1 plants to get the F2 generation and crossed a pure…

A: Introduction - The law of dominance, the law of segregation, and the law of independent assortment…

Q: 1. What do ascaris lumbricoides egg look like? 2. How can it infect a person? 3. How to prevent its…

A:

Q: Why do anisogamous organisms only experience the twofold cost of sex?

A: Anisogamy is a kind of sexual reproduction that involves the  fusion of two gametes that differ in…

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.