13. Examine the following pattern of an electrophoresis gel and Draw a restrictionmap of the DNA. Is this DNA circular or linear?121304 56000 bp5000 bp4000 bp3000 bp2000 bp1000 bp500 bpLane 1: DNA + EcoRILane 2: DNA + Hind IIILane 3: DNA + EcoR I +Hind IIILane 4: DNA onlyLane 5: DNA ladder

A restriction map is a map of known restriction sites within a sequence of DNA. This map is formed…

Examine the following pattern of an electrophoresis gel and Draw a restriction up of the DNA. Is this DNA circular or linear? 2 0 3 1 I 4 5 6000 bp 5000 bp 4000 bp 3000 bp 2000 bp 1000 bp 500 bp Lane 1: DNA + EcoRI Lane 2: DNA + Hind III Lane 3: DNA + EcoR I +Hind III Lane 4: DNA only Lane 5: DNA ladder

Examine the following pattern of an electrophoresis gel and Draw a restriction up of the DNA. Is this DNA circular or linear? 2 0 3 1 I 4 5 6000 bp 5000 bp 4000 bp 3000 bp 2000 bp 1000 bp 500 bp Lane 1: DNA + EcoRI Lane 2: DNA + Hind III Lane 3: DNA + EcoR I +Hind III Lane 4: DNA only Lane 5: DNA ladder

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
What information and materials are needed to amplify region of DNA using PCR?
1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at your container? 2. Is the DNA you extracted pure? What are the possible impurities? 3. What can we do with the DNA once we have purified it? Discuss different techniques and technologies associated with this.
1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference
1. what are the three main steps of a solid phase DNA extraction? Answer is Lysis, but does not include precipitation and purification 2. ) Most STR fragments used in human forensic analysis are composed of _____ repeats.
1. What is/are the purpose(s) of DNA extraction? 2. What is the function of each reagent used in the extraction of DNA from a banana? a. Saltwater b. Liquid dishwashing soap c. Cold isopropyl alcohol
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1. How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is SYBR green less toxic than EtBr? 3. What are the similarities and differences between Manual and Automated Sanger Sequencing? 4. What is the relationship between DNA fragment length and the distance it will run in a gel? (Restriction Enzyme Digestion)
5. Which of the following alternative steps cannot be employed in the DNA extraction because it would cause denaturation of some DNA? a. Using vodka instead of isopropyl alcohol. b. Using warm isopropyl alcohol instead of cold isopropyl alcohol. c. Using ammonium chloride for the soapy salt solution instead of sodium chloride. d. Using unscented and uncolored liquid soap for the soapy salt solution 6. Which property of DNA makes it possible to wrap it around the toothpick? a. DNA has a double-stranded helical structure b. DNA is color white. c. DNA is made up of long and thin strands. d. DNA carries genetic information
1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase b.Helicase c. Ligase d. Primase 2. After helicase unwinds the two DNA strands, ____________ bind to the single stranded DNA. This keeps the two single stranded DNA separated. a. Topoisomerase b. Single stranded binding proteins c. Ligae d. DNA polymerase 3. To synthesize a new strand of DNA, DNA polymerase requires: a. inorganic phosphate b.dNTPs (dATP, dCTP, dGTP, dTTP) c. a free 3' OH group d.ATP e. template DNA Please answer asap and type your answer and do not copy from anywhere please
1. Which of the following actions in the DNA extraction of strawberry separates the DNA from the rest of the solution? a. Addition of cold isopropyl alcohol b. crushing the strawberry c. Addition of soapy salt solution d. Filtration of the crushed strawberries 2. What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b. It displaced a lot of proteins to free the DNA. c. It disrupts the phospholipid bilayer. d. It precipitates the DNA.