16) The RNA dependent DNA enzyme: a. Is found in the mature hepatitis D virus. b. Is found in the mature hepatitis C virus. c. The end product of this enzyme is ssDNA d. This enzyme acts in the nucleus of the affected cell

16) The RNA dependent DNA enzyme: a. Is found in the mature hepatitis D virus. b. Is found in the mature hepatitis C virus. c. The end product of this enzyme is ssDNA d. This enzyme acts in the nucleus of the affected cell

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 1TYU: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain...

See similar textbooks

Related questions

Q: 3. What should be the highlight of health education and promotion activities for prevention and…

A: Bad sanitation can be contributing factor to the spreading of the disease related to parasites.…

Q: You're studying two lakes in neighboring valleys in the Cascades. One lake has a food web with three…

A: Based on the principles of trophic transfer, the lake with longer food web should have lower net…

Q: 12) The first discovered human virus is; a. Foot and mouth disease virus b. Tobacco mosaic virus. c.…

A: First discover human virus is Yellow Fever Virus.

Q: State for each of the following statements if they are true or false: a. Cumulative incidence ratio,…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the remaining…

Q: 11) The difference between SARS-Cov2 replication and FMDV replication? The antigenomic copy in…

A: Sars coronavirus disease 19 is a disease caused by a virus named SARS-CoV-2 and was discovered in…

Q: 1. Enumerate the 4 groups of coagulation factors according to function & opposite list the factors…

A: The normal range of platelets is up to 450,000 but if the number increased from this number it is…

Q: Why is it important to model cancer through the generation of induced pluripotent stem cells ?…

A: Medical technology has advanced significantly over the course of many centuries. According to…

Q: Provide an sufficient explanation as to how a positive interspecific distribution-abundance…

A: Distribution-abundance relationship tells about how the species which are widely spread in different…

Q: Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B.…

A: ANSWER;- B). A +3 frameshift mutation Explain;- A frameshift mutation is a type of mutation…

Q: The Escherichia coli chromosome is a circular DNA molecule and contains a single origin of…

A: Introduction : DNA replication in E.coli is a process through which daughter DNA synthesized from…

Q: Q.10. What is the role of microbes in reducing environmental degeneration caused by chemicals?

A: Microbes are organisms that are too small to see without the use of a microscope. They include…

Q: Inbreeding increases the frequency of ________ in a population. Question 73 options:…

A: Inbreeding is a term that indicates breeding between closely related individuals. On contrary,…

Q: discuss the terms genetically modified and transgenic in your own words.

A: * Genetically modified means genetic material either DNA or RNA of an organism has been artificially…

Q: Escherichia coli DNA sequence that cc

Q: )In many species of turtles, sex is not determined by sex chromosomes (like in mammals and birds)…

A: In most species, gender is determined during fertilization. However, the sex of most turtles,…

Q: What is 'stress' in plants? What are the types of stress in plants?

A: Introduction In this question we have to write about the 'stress' in plants.

Q: Answer the following questions: 1. Differentiate from fibrocyte. 2. What are dusts cells? fibroblast

A: The most common cell found in fibrous tissue is the fibroblast.. Fibroblasts secrete collagen…

Q: When Charles Darwin discovered the various fish species on the Galapagos islands he was surprised to…

A: Charles Robert Darwin, an English naturalist, suggested the "Theory of Natural Selection" by…

Q: What is the value of uv?

A: Introduction UV is the invisible rays that are part of the energy that comes from the sun, Excessive…

Q: Conduct a Chi-Square Test and indicate the p-value using this data: Parents: Mother is carrier;…

A: Chi-square test is a simple way of evaluating whether the predictions of a genetic hypothesis agree…

Q: 81) The RNA polymerase (RDRP) enzyme a. Can act on the nucleus only b. Can only be a viral enzyme.…

A: RNA dependent RNA polymerase is an enzyme that catalyzes the processes of RNA replication from RNA…

Q: a. How would you synthesize a pentaploid?b. How would you synthesize a triploid of genotypeA/a/a?c.…

A: The number of sets of chromosome in a cell or an organism termed as ploidy.Monoploid organisms have…

Q: Orangutans are an endangered species in their natural environment (the islands of Borneo and…

A: An endangered species is determined as a type of organism that has become threatened due to…

Q: what is the role HGF in pancreatic cancer?

A: * HGF is also known as Hepatocyte growth factor or scatter factor which is an paracrine cellular…

Q: Q.1. What is the role of Agrobacterium tumefaciens in plant transformation?

A: Introduction In this question we will discuss about the role of Agrobacterium tumefaciens in plant…

Q: a. Differences between: ii. Typical and atypical ova of Capillaria philippinensis

A: Nematodes are the organism belongs to animal kingdom . They are round worms which comprises of…

Q: A mRNA contains a codon with the sequence 5'-UAC-3'. What would be the most likely sequence of the…

A: tRNA read out m-RNA and synthesize polypeptide chain with the help of ribosome.

Q: In dogs, coat color is an autosomal dominant trait. The allele for a black coat is B and the allele…

A: 1) There are two phenotypes black or brown. A dog can any of these two coat colour. So, if we look…

Q: Predict the level of gene expression of the lac operon, as well as the status of the lac represso…

A: Operon functions as a single regulated unit composed of one or more structural genes, a promoter…

Q: You add 5 paramecia to a test tube and feed them bacteria. One week later the population has grown…

A: The exponential growth indicates that there is a constant growth over a certain period in the number…

Q: 5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use…

A: Yeast Saccharomyces cerevisiae (single-celled fungus microorganisms). Since ancient times, the…

Q: Explain telmoere cell maintaince. Give examples. Give a diagram to back your answer

A: Answer

Q: What are the steps to DNA replication?

A: DNA replication is responsible for producing complementary ds DNA molecule from parental dsDNA…

Q: Q.4. Describe the kind of food that would have lactic acid bacteria. Mention their useful…

A: Lactic acid bacteria are probiotic organisms, commonly used in fermented dairy products. They…

Q: What is the mitotic apparatus?

A: Introduction :- "Mitosis is the step in the cell cycle in which newly generated DNA is separated and…

Q: PCR errors during library amplification are one possible source of false positive results. If an…

A: PCR is a polymerase chain reaction. This is a biotechnology used to amplify the DNA copies.

Q: Show how you could make an allotetraploid between tworelated diploid plant species, both of which…

A: An allotetraploid is a hybrid with four times the number of chromosomes as a haploid organism. All…

Q: Spores released from a mushroom’s gills are_____ . a. flagellated c. dikaryotic b. produced by…

A: Introduction A mushroom, often known as a toadstool, is a fungus' fleshy, spore-bearing fruiting…

Q: Comparison between plants and humans defenses in DEFENSE MECHANISMS

A: Plants and animals are living organisms, they are more advanced than microorganisms. Plant and…

Q: Comparison between plants and humans defensess

A: Plants and human defense are different in some manner, though there are some similarities also

Q: Color in a species of minnows is determined by a single locus with two alleles: D and d. DD…

A: Hardy Weinberg principal shows that frequency of allels and genotypes remains constant from…

Q: xplain the events of translation initiation, elongation and termination

A: The translation is the process in which information in the mRNA is converted into amino acids and…

Q: 1. What are 2 similarities and 2 differences between the neuroendocrine regulation of metamorphosis…

A: The neuroendocrine system and its related signaling mediators, such as neuropeptides and biogenic…

Q: Which of the following processes would be directly affected by blocking the function of peptidyl…

A: Introduction :- Peptidyl transferase is the enzyme that creates peptide bonds during protein…

Q: Which statement is false according to the tree below? Hagfishes Lampreys Cartilaginous fishes Ray…

A: The phylogenetic tree for animals is given in the question. The phylogenetic tree depicts the…

Q: State two justifications for the use of scientific names and classifications of organisms.

A: The scientific naming of organisms is the field of taxonomy.

Q: Identify the anatomical microscopic parts (label the distinct parts in the slide specimen) of…

A: Amphibians are those vertebrates that can live in both land and water ecosystem and it includes…

Q: Q.19. List a few examples of biofortified crops. How do they benefit society?

A: Biofortification also known as biological fortification is a bio technique that implicates the…

Q: What is agricultue business

A: Agriculture is defined as the type of practice in which plants and livestock are being cultivated.…

Q: Explain and illustrate these processes; Endochondral Ossification, Intramembranous Ossification, and…

A: Development of bone begins from mesoderm in the embryonic life (from sixth week) and a good number…

Concept explainers

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.

Question

16) The RNA dependent DNA enzyme:
a. Is found in the mature hepatitis D virus.
b. Is found in the mature hepatitis C virus.
c. The end product of this enzyme is ssDNA
d. This enzyme acts in the nucleus of the affected cell

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

There have been recent outbreaks of dog flu in the US. Why doesn't this virus infect humans? A) The virus can replicate in cells of all species but can only egress from dog cells. B) The genetic code of the virus is the same as that in dog cells but is different from other organisms. C) The virus can only attach to dog cells. D) The virus can enter cells of all species but can only replicate in dog cells.
Why can’t retrotransposons move from one cell to another like retroviruses?a. Because they do not encode the Env proteinb. Because they are nonautonomous elementsc. Because they require reverse transcriptased. a and b are both true.
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruises
A biologist develops a new drug that seems to dramatically slow the onset of symptoms resulting from HIV infection. Close monitoring of HIV-infected cells reveals that the viral proteins are in the form of long polyproteins. What kind of drug did the biologist develop? A. It is a glycosyl transferase inhibitor. B. It is an integrase inhibitor C. It is a protease inhibitor. D. It is a CD4 inhibitor. please explain why which answer is correct and which is wrong and why
You have just isolated the covid-19 virus. Analysis of its genome reveals that it is composed of a single stranded RNA molecule containing 24% adenine. Based on this information, what would you predict the % cytosine to be? (a) 24% (b) 26% (c) 48% (d) 52% (e ) Cannot be determined from the information given
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
An experimental drug therapy to treat patients with antibiotic-resistant bacteria involves introduction of a highly specific bacteriophage to the infected patient's bloodstream. Which of the following bacteriophage types would be the LEAST useful for this therapy? a. a lytic bacteriophage b. An enveloped virus c. An RNA virus d. a lysogenic bacteriophage
what event occurs in bacteriophage multiplication that does not occur in animal virus replication?A,B,C,D, or E? a. adsorption to the host cells. b. injection of the viral nucleic acid into the host cell. c. host cell synthesis of viral enzymes and capsid proteins. d. assembly of nucleocapsids. e. replication of viral nucleic acid.
What is the significance of negative strand synthesis of positive a ssRNA virus? a. Loss of Function b. Transcription of negative and positive strands c. Ensures that mutations are less likely to occur to the genetic material d. Acts as complementary template for the positive strand
If a virus particle contained double-stranded B-DNA of 500,000 base pairs, A. How many complete helical turns would occur on each strand? B. How many atoms of phosphorus would be present? C. What would be the length (in Å) of the DNA before packing into the virus?
Many viruses enter host cells through receptor-mediated endocytosis, What is an advantage of this entry strategy? A. The virus directly enters the cytoplasm of the cell B The virus only enters its target host cell type. C. The virus is protected from recognition by white blood cells. D. The virus can directly inject its genome into the cell's nucleus.
Which receptor of the influenza virus is most involved in binding tothe respiratory cells?a. neuraminidase spikes b. hemagglutinin spikes c. the viral capsid d. the viral envelope