which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruises

which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruises

Name: which of these describes the symptoms of the disease(s) caused by muta
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that applya. Thread-like blood vessels in eyesb. Excessive bleedingc. Dwarfismd. UV light sensitivity e. sunburn f. Bruises

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter41: Neural Signaling

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colon
Mutations ________. a. are always bad b. have variable impacts c. are usually beneficial
Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxia
Enhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 1. In the first, how many days did it take unmodified mice to learn to find the location of the hidden platform within 10 seconds?
Which is true about Creutzfeldt-Jacob disease? Select all that apply. O it is caused by a prion O It is caused by an abnormally folded protein O Normal proteins are induced to begin folding abnormally, resulting in progression of the disease It affects brain tissue [ It is always fatal
Currently, a few heritable human diseases ________ treated with some success by introducing a normal copy the gene into the patient’s cells. a. have NOT been b. have been
What might best explain why the incidence of cancer increases as people age? Select one: a. mutations accumulate as people age b. cell division increases as people age c. protein synthesis increases as people age d. telomerase activity increases as people age e. ATP production increases as people age
The normal function of the Rb protein is toa. act as a brake on cell division.b. produce retinoblastoma.c. facilitate retinal pigmentation.d. initiate DNA replication.
With current genetic tests, a negative result does notnecessarily rule out future development of a disease, nordoes a positive result always mean that an individual willget the disease. How can we effectively communicate theresults of testing and the actual risks to those being tested?
Genetic Diseasesa. List the differences between infectious and genetic diseases.b. Discuss the reasons why genetic diseases could hardly be diagnosed in fish.c. Describe the how albinism occur in fish and why it is considered a disease.d. List other fish species, documented to exhibit albinism.e. Elucidate the process by which melanoma or skin cancer-prone sword tail develops. Describethe genetic mechanism involved.f. Describe how domestication can lead to genetic problems in aquaculture.
Epistatic mteraction means that one gene----------the effect of another gene.(A) Prometic (B) Mask(C) Accelerate(D) None of these
Hello! Can you please explain why D is correct?