1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5     3 - GCCTACGGGCATATG -5     5 - GCCTACGGGCATAAG -3     5 - GCCTACGGGCATATG -3     3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ?     3 - GCCTACGGGCATATGGTA -5     5 - GCCTACGGGCATAAGGAT -3     5 - GCCTACGGGCATATGCAT -3     3 - CGGATGCCCGTATACCTA -5

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'?…

A: As per our guidelines we are supposed to answer only 3 sub parts.

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: The transcription is intended to generate an RNA copy of the DNA sequence for the gene. The RNA…

Q: 2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence…

A: Introduction :-  The synthesis of m-RNA by using template 3'-5' DNA strand is known as…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA   1. In…

A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE)…

A: DNA, RNA, AND PROTEIN SYNTHESIS blank is filled below.

Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…

A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…

Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…

A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…

A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…

Q: Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…

A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…

Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…

A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…

Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…

A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase…

A: The image shows 10 statements. We have to determine whether the statement is True or False. The…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: ) Assuming that transcription starts with the first C in the template strand, and continues to the…

A: Transcription  Transcription is the process in which the template strand of DNA is copied into mRNA…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: 90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the…

A: Ribonucleic Acid ( RNA ) -- Ribonucleic acid is also a type of nucleic acid found in the living…

Q: Frameshift Insertion Mutation – Can be one or more nucleotides. 5’   ATG   GGG    AAA    GAT    TAT…

A: Any heritable change in an individual's genetic makeup is referred to as a mutation. It's when a…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: Consider the following DNA template:   5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA  (b) tRNA…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…

Q: 8. You have a piece of DNA with the sequence shown below.…

A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Here i discuss about the coding strand, antisense strand of DNA, their transcribed products as well…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…