A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment with XbaI(X) sites on both ends was then further digested with HindIII (H) and EcoRI (E).  Draw a restriction map of the linear fragment based on the gel electrophoresis results shown below.  X         H         Marker             E          H/E                           __2000bp __                    __1500b                         __1300bp        __             __        __1000bp                    __                         __700bp             ­­__        __500bp                         __400bp                         __300bp                      __                         __200bp          __        __                         __100bp

Q: Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to…

A: Bg2(B) contians restriction site in between Pst1 and Kpn1. Given plasmid have one restriction site…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the…

A: Restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the…

A: Restriction endonucleases, often known as restriction enzymes, are found in all prokaryotes. The…

Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…

A: Restrictions enzyme or restrictions endonucleases is type of protein, produces bacteria that helps…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…

Q: You have a DNA sequence of 1800 bp. To characterize it, you decide to make a restriction map.…

A: Restriction mapping is a process that helps to determine the location of the restriction site. The…

Q: Sickle cell anaemia is caused by a mutation in the HBB gene. The normal wild-type βA allele contains…

A: Sickle cell anemia is a result of a mutation in the HBB gene. This gene contains the restriction…

Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…

A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…

A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment  after breaking…

Q: The detection of single nucleotide polymorphisms is possible with: O A. Restriction Enzymes O B. All…

A: SNPs or single nucleotide polymorphisms are the most common type of genetic variation in humans.…

Q: Hindl EcoRI ECORV BamHI 373 Salt Pstl. tet amp Plasmid 1000 DBR322 4361 be ori Ndel you were going…

A: Restriction enzymes or restriction endonucleases/exonucleases are enzymes capable of recognizing a…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…

Q: Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites…

A: Restriction enzymes are specific endonuclease that can cut a DNA at a particular sequence.…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: You performed RADseq analysis of two genomes using the restriction enzyme EcoRI. From each genome,…

A: * Restriction site associated DNA (RAD) markers are genetic marker that are used for association…

Q: Suppose that a geneticist discovers a new restriction enzyme in the bacterium Aeromonas ranidae.…

A: Restriction enzymes or restriction endonucleases are the enzymes that cut the DNA strand at specific…

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…

A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…

Q: A purified piece of DNA of 1650bp is cut with Hind III and Pst I separately and then with both…

A: Restriction enzymes are endonucleases derived from bacteria that make a double-stranded cut in the…

Q: Identify the basic steps (in right order) in AFLP marker analysis. Explain briefly how this marker…

A: Basic steps in AFLP marker analysis.

Q: Explanation of why mutations vary in likelihood of causing disease depending on location relative to…

A: Phenylketonuria is caused due to a genetic mutation in the PAH gene( phenylalanine hydroxylase…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…

Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…

A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .

Q: Dr. Doom has a DNA sequence of 2000 bp. Enzyme X and Enzyme Y restriction sites and their positions…

A: Restriction enzymes are the enzymes which cut DNA at particular site.

Q: Electrophoresis data: Measure the distance (in millimeters) that each fragment traveled from the…

A: Introduction Gel electrophoresis is a laboratory technique for separating DNA, RNA, and protein…

Q: Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of…

A: The molecule, which is responsible for the genetic inheritance in most living organisms is…

Q: The following bacterial DNA genome is composed of three sequences: TGGCGGT / ACGTTAC / GGATAGG Using…

A: Clustered regularly interspaced short palindromic repeats or CRISPR is a family of nucleotide…

Q: An 800 bp fragment is completely digested with a single restriction enzyme. Fragments of 50*, 150*,…

A: Restriction enzymes are those enzymes which recognize and cleave at a particular sequence. In this…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: The plasmid map can be created by checking the individual band patterns and band patterns with a mix…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: A restriction enzyme, also known as a restriction endonuclease, is a bacterial protein that cleaves…

Q: f restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up…

A: Nucleases are enzymes that degrade nucleic acids. They can be classified into RNase   : enzymes…

Q: If the Hinfl restriction enzyme recognizes G^ACTC sites, as seen in the image, belUW. GACTC How many…

A: The cloning of DNA is the mechanism by which a certain fragment of DNA is multiplied. The selected…

Q: An E. coli genomic DNA fragment is run out on a gel undigested (U), and then with two different…

A: Restriction enzymes are those enzyme which recognise a specific recognition site in DNA and cuts the…

Q: For the given restriction enzyme: BslI (CCNNNNN^NNGG)  i) Approximately how many fragments would…

A: Restriction endonucleases are enzymes that does cleavage of DNA at specific sites. These specific…

Q: Suppose that a geneticist discovers a new restriction enzyme in the bacterium Aeromonas ranidae.…

A: Restriction enzymes are found in bacteria, their function is to recognise and cut a specific site on…

Q: U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…

A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…

Q: It is difficult to use a restriction enzyme that cuts (shown as ) within one of these restriction…

A: Ans- It is difficult to use a restriction enzyme that cuts like the sequence given in option D( *…

Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…

A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…

Q: #2 EcoRI --- 5’ G ↓AATTC 3’   5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’  3’ TGC…

A: Restriction enzymes is an enzyme that cleaves DNA into fragments. Recognition sequence is a unique…

Q: The gel profile has plasmid DNA digested by different restriction enzymes in lanes 1 to 4 (left to…

A: First option is incorrect because in the given diagram of plasmid DNA gel profile the DNAs in lanes…

Q: The recognition site of some restriction enzymes are shown. Which will produce sticky ends?     A.…

A: Restriction enzymes also known as restriction endonucleases are the enzymes which acts on the…

Q: The recognition sites for the restriction enzymes BamHI, Xbal, and Bglll are G^GATCC, T^CTAGA, and…

A: Since it is the multiple choice question i will provide answer in next step.

Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…

A: The correct option is b 5'CCATTGG3'. Sanger sequencing ( method of DNA sequencing and it involves…

Q: 3 HaelII --- 5’ CC ↓ GG 3’   5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’…

A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…

Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…

A: The Sanger sequencing method is also called as chain termination method. In this method, dideoxy…

Q: A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gel…

A: The breaking apart or fragmentation of DNA strands is known as DNA fragmentation. It might be done…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.