19. You run a PCR of the above HBB sequence using the primers you designed. You receive a vectorfrom a company that you want to clone your HBB PCR product into. Below is the vector:BamHI0.5 kbEcoRI1.0 kb0.3 kb-Bglllplasmid A0.2 kbBamHI0.4 kbHindIII1.0 kbEcoRIYou want to cut this vector with BamHI and EcoRI andinsert your PCR product into this vector. After cuttingthe vector with both enzymes simultaneously you runa gel.i) On the gel below draw the bands you expect to see after you cut this vectorwith these enzymes at the same time (only use one gel lane - the other oneis going to be empty). (6 points)Ladder5kb3kb2.5kb2kb1.5kb1kb0.5kb0.3kb0.2kbii) Circle the band that represents the backbone that you will insert the PCRproduct into. (2 points)c) Once you have inserted the PCR product into the plasmid backbone from part C, howmany bp will the new vector be (the total of the backbone and the PCR producttogether). Answer should be 2 significant figures. (2 points)

i) Gel Electrophoresis Bands:- The ladder serves as a reference for the sizes of the DNA fragments.-…

Answered: 19. You run a PCR of the above HBB…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
1. What two restriction sites are you going to use to clone your PCR product into the pL4440 plasmid? What are their DNA sequence? 2. State the primer sequence you will use to amplify the F27C1.7 gene ready to be cloned into the pL4440 plasmid? 3. How would you go about cloning this amplified DNA into pL4440? Using your knowledge of cloning list 5 important aspects of the method.
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
1. What happens in the denaturing step of PCR? A. What happens during the annealing step of PCR? B. What happens during the extension step of PCR? C. What temperatures is associated with each PCR step? D. Why is it necessary to have a primer on each side of the DNA segment to be amplified? (Hint: draw it out to see what happens with only one primer). E. How did the Taq DNA polymerase acquire its name? F. Why are there nucleotides (A, T, G, C) in the master mix? What are the other components of the master mix and what are their functions?
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20 nuclear tides in length. partial results are depicted on the gel below which of the following are true?
On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
You would like to amplify the gene shown here using PCR. Assume the primer to the 5' end of the gene sequence shown has already been designed. You need to design a primer to hybridize with the sequence on the right side of the diagram. What will be the sequence of the primer? 5’ —GENE——AATTGGCG 3’ a) 3’ CGCCAATT 5’ b) 5’ GCGGTTAA 3’ c) 5’ CGCCAATT 3’ d) 5’ TTAACCGC 3’ e) 5’ AATTGGCG 3’
a）What two restriction sites are you going to use to clone your PCR product into the pL4440 plasmid? What are their DNA sequence? b) State the primer sequence you will use to amplify the F27C1.7 gene ready to be cloned into the pL4440 plasmid? c) How would you go about cloning this amplified DNA into pL4440? Using your knowledge of cloning list 5 important aspects of the method.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS