You would like to amplify the gene shown here using PCR. Assume the primer to the 5' end of the gene sequence shown has already been designed. You need to design a primer to hybridize with the sequence on the right side of the diagram. What will be the sequence of the primer? 5’ —GENE——AATTGGCG 3’ a) 3’ CGCCAATT 5’ b) 5’ GCGGTTAA 3’ c) 5’ CGCCAATT 3’ d) 5’ TTAACCGC 3’ e) 5’ AATTGGCG 3’

You would like to amplify the gene shown here using PCR. Assume the primer to the 5' end of the gene sequence shown has already been designed. You need to design a primer to hybridize with the sequence on the right side of the diagram. What will be the sequence of the primer? 5’ —GENE——AATTGGCG 3’ a) 3’ CGCCAATT 5’ b) 5’ GCGGTTAA 3’ c) 5’ CGCCAATT 3’ d) 5’ TTAACCGC 3’ e) 5’ AATTGGCG 3’

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 1ITD: You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies...

See similar textbooks

Similar questions

You would like to amplify the gene shown below using PCR. What is the sequence of the primer you would generate for the left side of the sequence? a) 5’ GCGGTTAA 3’ b) 5’ CGCCAATT 3’ c) 5’ TTAACCGC 3’ d) 5’ AATTGGCG 3’
In a transformation experiment, donor DNA was obtained from aprototroph bacterial strain (a+b+c+), and the recipient was a tripleauxotroph (a-b-c-). What general conclusions can you draw aboutthe linkage relationships among the three genes from the followingtransformant classes that were recovered? a+ b- c- 180 a- b+ c- 150 a+ b+ c- 210 a- b- c+ 179 a+ b- c+ 2 a- b+ c+ 1 a+ b+ c+ 3
You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)
You are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from cheek cells of different people and amplified by PCR. When viewing the bands on the electrophoresis gel, one would expect that a taster (homozygote) would have---------band(s), whereas a carrier (heterozygote) would show--------band(s), and a non-taster would show------band(s).
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
In pcr experiment, Does electrophoresis show that only DNA products of the desired size are present? If not, what do you think is the reason?
In a transformation experiment involving a recipientbacterial strain of genotype a- b-, the following resultswere obtained. What can you conclude about the locationof the a and b genes relative to each other? Transformants (%)Transforming DNA a+ b- a-b+ a+b+a+b- 3.1 1.2 0.04a+b- and a-b+ 2.4 1.4 0.03
Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’
You want to amplify a specific region of DNA during PCR. Your primers should a Both should be an exact replica of the beginning of the specific gene you want to amplify b Both should be complementary to the beginning of the specific gene you want to amplify c One primer should be identical to the beginning of the gene sequence while the other is identical to the end of the gene sequence d One primer should be complementary to the beginning of the gene sequence while the other is complementary to the end of the gene sequence e One primer should be identical to the beginning of the gene sequence while the other is complementary to the end of the gene sequence
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?
You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
What are the benefits of using a mixture classification scheme as outlined in DNA Box 14.1? What would be the advantages of using software for deciphering mixture components?