1. The following protein crystal structure is the Human Serum Albumin complexed withoctadecanoic acid (PDB ID: 1E7I).According to the protein data bank, Human Serum Albumin is composed of 72% helical structure.Among the following options (a-c), select the possible Ramachandran plot for the above HumanSerum Albumin.(a)(b)(c)PhiPhiPhi 2. Fill in the blank: Identify the type of non-covalent/covalent interactions present in the followingprotein tertiary structure at physiological condition. Be specific about the type of interactions. 1H-O0-Hон онÇH,CH,CH,HCH,- NH;CH-OH0-CH,QQQ

The Ramachandran plot is a graph plot between phi (φ) and psi (ψ) the torsional angles of the…

2. Fill in the blank: Identify the type of non-covalent/covalent interactions present in the following protein tertiary structure at physiological condition. Be specific about the type of interactions. 1 H-O H. 0-H он он CH, CH3 CH NH CH.- OH 0–CH,

2. Fill in the blank: Identify the type of non-covalent/covalent interactions present in the following protein tertiary structure at physiological condition. Be specific about the type of interactions. 1 H-O H. 0-H он он CH, CH3 CH NH CH.- OH 0–CH,

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: 20. Which of the following does NOT contribute to the tertiary structure of proteins? a. salt…

A: Proteins are made of polypeptide chain/(s), which are polymers of amino acids. Adjacent amino acids…

Q: 1. Determine whether each of the following statements describes the primary, secondary, tertiary, or…

A: 1.a peptide bond is the back bone of the protein chain. It is the amide linkage in which COOH of one…

Q: 1. What is the charge of the primary structure of proteins at pH = 2.0, 4.0,6.0 and 11.0 of the…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: 4) Which level of protein structure would be most affected by the following changes... a) mutation…

A: Sequence of amino acids linked by peptide bond and their arrangements in space leads to the…

Q: 1.What reactive groups are involved in the formation of a peptide bond? 2.A molecule of what…

A: Proteins are the polymers of amino acids that are found during the translation process and proteins…

Q: 3. Quaternary protein structures are formed by spontaneous assembly of individual polypeptides a.…

A: Disclaimer: Since it is not mentioned which question is to be attempted, only the first question is…

Q: 4. Draw the example of Ramachandran plot for: A) regular secondary structure (4=60-65; y-60-80) B)…

A: Ramachandran plots depict the combination of backbone dihedral angles and statistical distribution.…

Q: 4. Choose any amino acid and show, by diagrams of your own creation, how pH will modify the charge…

A: Amino acids are organic compounds that contain amine (-NH2) and carboxylic (-COOH) functional groups…

Q: 5. The tertiary structure of a protein involves attractions and repulsions between the side chain…

A: The tertiary structure of the protein is stabilized by two types of bonds. 1. Covalent bond: The…

Q: 6. All 20 amino acids have A. one chiral carbon B. one n-carbon C. one carboxyl group D. ionizable R…

A: Proteins are made up of amino acids. Amino acids are linked by peptide bonds, this simple structure…

Q: 4. What is the highest level of protein structure evident in the photo above? What types of bonds…

A: Protein Proteins are the large group of biomolecules which requires by the organism in many…

Q: 1. Classify the 20 common amino acids A. According to type of side chain, R group a. Neutral amino…

A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…

Q: 1. The protein illustrated below was isolated from a superhuman being. Scientists theorized that it…

A: Introduction: Amino acids are the building blocks of protein that are joined together via peptide…

Q: 2) What is glycoside ? In neutral and basic solutions, glycosides do not show mutarotation. However,…

A: Carbohydrates are simple sugars that consist of carbon, hydrogen, and oxygen atoms in their…

Q: 1. What is hemoglobinopathy? What is sickle-cell anemia? Explain the concept relating to protein…

A: Hemoglobinopathy is a group of inherited blood disorders which occurs due to abnormal production or…

Q: 4. Alpha helices, loops, and beta sheets are examples of protein secondary structure. Beta sheets…

A: Protein secondary structure is maintain by intrachain H-bond or interchain H-bond. In α-helix H-bond…

Q: 3. Draw the structure of a protein containing 3 amino acids and then explain the process of…

A: Proteins are a class of complex macromolecules essential for the human body. Proteins are formed by…

Q: 2. Calculate the pI of the following primary structure of protein A) Lys- Gly- Ala- Gly B) Lys-…

A: Since you have asked a question with multiple subparts, we will answer first 3 subparts for you. In…

Q: 7. Native conformation of proteins may result from: a) hydrophobic interactions b) H-bonds c) ionic…

A: Proteins - Proteins are the macronutrients which are used for the building up of the muscles in the…

Q: 1. Classify the 20 common amino acids B. According to Polarity d. Uncharged nonpolar e. Uncharged…

A: Living body consists of numerous different amino acids amongst which only 20 are standard amino…

Q: 1. What class of biomolecules does this compound belong to? Explain why. 2. Break this compound down…

A: A biomolecule is any of the numerous substances that are produced by the cells and living organisms.…

Q: 4. Which level of protein structure do proteins need to function (there may be more than one correct…

A: Primary structure of protein is correct odering of amino acids chain. Exact sequence is very…

Q: 1. Recognize the following types of biomolecules when given images such as the ones below and on the…

A: Introduction Biomolecules are substances that are produced by biological organisms. These are…

Q: 6.All of the following types of interactions cooperate in stabilizing the tertiary structures of…

A: Tertiary structure of protein is three dimensional structure of protein which is formed by single…

Q: 4. What would be the most possible interaction between the side chains (R-group) of isoleucine and…

A: The peptide bond is formed between the alpha amino and the alpha carboxyl groups of amino acids and…

Q: 4. A particular amino acld inside or the outside of the folded protein? Briefly explain. on the

A: Amino acid in nature has the same fundamental structure. It consists of a carbon atom, the alpha (α)…

Q: 3. With suitable examples, compare the structural and functional differences between a fibrous and…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Fill in the blank: Identify the type of non-covalent/covalent interactions present in the following…

A: The Ramachandran plot also termed as Rama plot is the way to visualize the position of backbone…

Q: 3. Which of the following processes involves the loss of a protein’s native structure?…

A: Proteins are polypeptides made up of amino acids. The biochemically and structurally stable form of…

Q: 6. How are amino acids linked together in a protein molecule? Write the general structure of the…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: Explain the significance φ, ψ contour diagram in proteins and explore how is it interpreted?

A: The contour plot of phi and psi dihedral angles is also called the Ramachandran plot. Ramachandran…

Q: 4. Observe the following diagram carefully and answer the following questions. (a) Identify the "B"…

A: Biomolecules are molecules that are associated with the biochemical reactions in cells. Cells…

Q: 2. The following bonds help to hold together protein tertiary structure. Which order below reflects…

A: Protein structure: Proteins are the most abundant biomolecule of the living system that constitutes…

Q: 7) Which level of protein structure is when the protein is actually capable of being functional?…

A: Proteins are macro-biomolecules made up of amino acids subunits joined by peptide bonds.

Q: 8) The figure show an unfolded polypeptide consisting of six amino acids. Descrībe how cooperativity…

A: Alpha Helix is one of the most frequently encountered secondary structure in proteins due to its…

Q: 1. Most of the work in the body is done by proteins. Describe the function of each of the proteins:…

A: Proteins are large, complex molecules that play many critical roles in the body. They are required…

Q: 2. Identify the structural level in each protein. A) quaternary structure B) tertiary structure C)…

A: Proteins are the unbranched polymer of amino acids. There are four level of structural organization…

Q: If the pKa of a carboxyl group in a protein is approximately 4.5, at pH 5.5 the ratio of carboxylate…

A: pH at which 50% acid dissociate called its pKa. Buffer solutions often are weak…

Q: 2. Which of the following statements is TRUE? A. The primary structure of proteins is often depicted…

A: Question 2 : The primary structure of Protein is often depicted by Ribbon diagrams where helices are…

Q: Describe in detail how to detect the primary structure of protein.

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: 5. How would the following fatty acid be characterized? A. short chain, saturated B. medium chain,…

A: Fatty acids are the long-chain lipid carboxylic acids found in the body. these are two types based…

Q: Protein are folding to have a globular shape because they need to maximize O a. the number of…

A: Proteins are one of the macromolecules that is essential for the normal functioning of the human…

Q: 6. Below are the structures of 3 amino acids. #25 #3- tH,N-C-coo- + HN-c-coo- +HaN-¢-co0- CH2 CHz a.…

A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…

Q: 3) Give three examples of where we find proteins in our bodies. a. b. с. Draw the structural formula…

A: Proteins are made up of amino acids. The amino acids are the building block of proteins, and…

Q: 1. Which one of the following is NOT an important functional group or linkage in biomolecules? A)…

A: A particular moiety or a substituent in a molecule that is responsible for the unique…

Q: 1. It is important that you are familiar with the bonding within major macromolecules -…

A: 1) maltose: maltose is formed by a starch (homopolysacharide) is undergone enzymatic hydrolysis and…

Question

1. The following protein crystal structure is the Human Serum Albumin complexed with
octadecanoic acid (PDB ID: 1E7I).
According to the protein data bank, Human Serum Albumin is composed of 72% helical structure.
Among the following options (a-c), select the possible Ramachandran plot for the above Human
Serum Albumin.
(a)
(b)
(c)
Phi
Phi
Phi

2. Fill in the blank: Identify the type of non-covalent/covalent interactions present in the following
protein tertiary structure at physiological condition. Be specific about the type of interactions. 1
H-O
0-H
он он
ÇH,
CH,
CH,
H
CH,
- NH;
CH-OH
0-CH,
QQQ

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

The interactions between the 2 a and 2 b subunits of hemoglobin represent what type of protein structure?
The molecular formula for glucose is C6H12O6. What would be the molecular formula for a polymer made by linking ten glucose molecules together by dehydration reactions? Group of answer choices A. C60H120O60 B. C60H102O51 C. C60H100O50 D. C60H111O51 Use the following information to answer the following questions."The native structure of hemoglobin (HB) comprises of two α and two β subunits, each of which carries a heme group. There appear to be no previous studies that report the in-vitro folding and assembly of Hb from highly unfolded α and β globin in a 'one-pot' reaction. One difficulty that has to be overcome for studies of this kind is the tendency of Hb to aggregate during refolding. This work demonstrates that denaturation of Hb in 40% acetonitrile at pH 10.0 is reversible." (J Am Soc Mass Spectrum 2007, 18, 8-16)In sickle-cell disease, as a result of a single amino acid change, the mutant hemoglobin tetramers associate with each other and assemble into large fibers.…
What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
After staining an SDS-PAGE gel with Coomassie Blue G-250, the protein bands are visualized by de-staining the gel in a Coomassie Blue G-250 de-staining solution. This solution is made up of 10% acetic acid, 50% methanol, and 40% distilled water. How much of each of these components do you need to prepare 5 liters of Coomassie Blue G-250 de-staining solution?
Based on molecular weights of purified (no beta-Me) and (beta-Me) sample, which are 140 kDa and 72 kDa, what can be said about the number and size of the protein monomers, as well as the nature of the bonds holding together the complete quaternary structure of the proteins?
Hemoglobin is considered to be a tetrameric complex with a 64 kDa (α β)2. When attempting to purify hemoglobin, we must first purify the α and β monomers (about 16 kDa each) to prepare the tetramer. This is formed from the dimer intermediate: 2 α + 2 β -> 2 αβ -> (α β)2. The graph given represents a size-exclusion chromatogram after the refolding of the hemoglobin tetramer Using the size-exclusion chromatogram given, 1. Draw an SDS-Page Gel with a reducing agent such as BME using the three peaks listed on the graph.
6 Concanavalin (ConA) is a 25.5KDa protein with pI of 4.7 and optical absorbance (A 0.1% 289) of 1.14. calculate the concentration of an aqueous solution of pure BSA protein with an absorbance of 0.66 at 280nm. give your answer in units of mg/ml ?
Following are two structural formulas for (S)-serine, one of the building blocks of proteins Is (S)-serine better represented by structural formula A or B?
What is the biologically-preferred stereochemistry and ionization states for the pentagon-peptide CANDY at a pH of 7?
The ionization of p-nitrophenol is shown below (pKa = 7.0): a. Identify the weak acid and conjugate base. b. At pH 7, what are the relative concentrations of ionized and un-ionized p-nitrophenol? c. If enough concentrated hydrochloric acid is added to a solution of p-nitrophenol to lower the pH from 7 to 5, what will happen to the relative concentrations of the ionized and un-ionized forms? d. Ionized p-nitrophenol has a yellow color, while the un-ionized form is colorless. The yellow color can be measured using a spectrophotometer at 400nm. In order to determine the total amount of p-nitrophenol in a solution, would you perform the spectrophotometer reading at an acidic or basic pH? Clearly explain why? e. A solution of p-nitrophenol at pH 7.95 was found to have an A400 of 0.255 . What is the total concentration (in µM) of p-nitrophenol (ionized plus un-ionized) in the solution? The molar extinction coefficient of p-nitrophenol is 18,500 M-1cm-1 and the pKa is 7.
Glucose-1-phosphate has a ΔG°′ value of −20.9 kJ/mol, whereas that for glucose-6-phosphate is −12.5 kJ/mol. After reviewing the molecular structures of these compounds, explain why there is such a difference in these values.
Some characteristics of three proteins are listed in the table below: Protein Molecular Weight (Da) Isoelectric point (pI) Does the Protein Contain a heme moiety? 1 75,000 5.0 No 2 12,500 4.8 No 3 73,000 9.8 Yes a. What type of chromatography separates proteins based on their size? b. What type of chromatography separates proteins based on their charge? c. Could gel filtration chromatography be used to separate a mixture containing Protein 2 and 3? Clearly explain why or why not. If gel filtration chromatography can be used to separate Protein 2 from Protein 3, which protein would elute first (clearly explain why)? After collecting the fractions from the column, the absorbance of each fraction will be measured using a spectrophotometer. Can both proteins (Protein 2 and Protein 3) be monitored at 280nm and 400nm (clearly explain)? d. Which 2 proteins listed in the table above could be separated by ion exchange chromatography but NOT by…