21.3 LAB: Midfix of 3 The midfix of 3 is the middle 3 characters of a string. Given a string input, output the middle three characters of that string. Assume the word length is always odd and at least three characters.Ex: If the input is:xxxtoyxxx the output is:Midfix: toy Use Python, please. LAB21.3.1: LAB: Midfix of 30/10АCTIVITYmain.pyLoad default template..1 ''' Type your code here. ''2Run your program as often as you'd like, before submitting for grading. Below, type any neededinput values in the first box, then click Run program and observe the program's output in theDevelop modeSubmit modesecond box.Enter program input (optional)

21.3 LAB: Midfix of 3 The midfix of 3 is the middle 3 characters of a string. Given a string input, output the middle three characters of that string. Assume the word length is always odd and at least three characters. Ex: If the input is: xxxtoyxxx the output is: Midfix: toy Use Python, please.

21.3 LAB: Midfix of 3 The midfix of 3 is the middle 3 characters of a string. Given a string input, output the middle three characters of that string. Assume the word length is always odd and at least three characters. Ex: If the input is: xxxtoyxxx the output is: Midfix: toy Use Python, please.

EBK JAVA PROGRAMMING

8th Edition

ISBN:9781305480537

Author:FARRELL

Publisher:FARRELL

Chapter16: Graphics

Section: Chapter Questions

Problem 1DE

See similar textbooks

21.3 LAB: Midfix of 3

The midfix of 3 is the middle 3 characters of a string. Given a string input, output the middle three characters of that string. Assume the word length is always odd and at least three characters.

Ex: If the input is:

xxxtoyxxx

the output is:

Midfix: toy

Use Python, please.

LAB
21.3.1: LAB: Midfix of 3
0/10
АCTIVITY
main.py
Load default template..
1 ''' Type your code here. ''
2
Run your program as often as you'd like, before submitting for grading. Below, type any needed
input values in the first box, then click Run program and observe the program's output in the
Develop mode
Submit mode
second box.
Enter program input (optional)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

Angular provides a HttpClient class used to make requests to web servers. HttpClient provides a get() function which takes as parameter the URL to connect to and returns an observable which can be used to observe the response coming back from the server. Assume that you have an instance of HttpClient in a variable called http. Write some code for calling the get function with a URL string, and subscribing to the resulting Observable with a function to print the result to the console.
A .The following JavaScript command adds a method to a built-in class that can be called on any object instance of that class.Array.prototype.scramble = function() { this.sort(function() { return 0.5 – Math.random(); });} Select one: True False B. Suppose you have written a JavaScript for loop, and one of the statements that will execute with each iteration of the loop includes an anonymous function that uses the for loop’s counter variable, i. Which statement about this loop is true? a.The anonymous function will execute when it is called by the program, using the value ofiat the time it was encountered in the loop. b. The anonymous function will throw an error if it is called by the program after theforloop has finished iterating. c. The anonymous function will execute when it is called by the program, using the value ofiafter the final iteration of the loop. d.The forloop signals the JavaScript interpreter to copy the body of the anonymous function but not its…
47. What statement of the following is the most appropriate? Group of answer choices The node class defined in the textbook can be implemented as a template class, providing more limitation to implement other container classes. The node class defined in the textbook can be implemented as a template class, providing more memory leak possibility to implement other container classes. The node class defined in the textbook can be implemented as a template class, providing more flexibility to implement other container classes. The node class defined in the textbook can be implemented as a template class, providing more tool box to implement other container classes. The node class defined in the textbook can not be implemented as a template class.
Suppose you have Java source files under the directorieschapter1, chapter2, . . . , chapter34. Write a program to insert thestatement package chapteri; as the first line for each Java source file underthe directory chapteri. Suppose chapter1, chapter2, . . . , chapter34are under the root directory srcRootDirectory. The root directoryandchapteridirectory may contain other folders and files. Use the followingcommand to run the program:java Exercise12_18 srcRootDirectory
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
1. A list of students (student ID, first name, last name, list of 4 test grades) will be transformed intoStudent objects. We will provide this file for you.a. Each feature will be separated by commas, however; the grades will be separated byspaces, as shown in this example line: 82417619,Erik,Macik,95.6 85 100 88[Hint: It seems like you might need to use the split method twice]b. Your program should work with any file with any number of lines.2. A menu will be displayed on loop to the user (meaning after a user completes a selection, themenu will be displayed again, unless the user exits).The menu options should be the following:a. View Student Grade and Averageb. Get Test Averagec. Get Top Student per examd. Exit3. Your system shall incorporate the following classes. Each class will require one file.GRADE CALCULATORPurposeA class that contains useful methods that can be used to calculate averages andconvert grades to letter gradesAttributes: NoneMethodsconvertToLetterGrade(double…
do some changes in code and make it unique #include <stdio.h>#include <stdlib.h>#include<string.h>//declaring functionsvoid firstFit(int [], int , int [],int );void bestFit(int [], int , int [],int );void worstFit(int [], int , int [],int );//starting programint main() {//declare partitions and processint partitions [] = {110, 450, 100, 250, 500};int processes [] = {212, 417, 112, 426};//getting their sizesint size_partitions = sizeof(partitions )/sizeof(partitions [0]);int size_processes = sizeof(processes )/sizeof(processes [0]);printf("Partitions size: ") ;for (int i=0; i<size_partitions; i++){printf("%d\t" ,partitions[i] );}//index partprintf("\nPartitions index: " );for (int i=0; i<size_partitions; i++){printf("%d\t" ,(i+1)) ;}printf( "\n" );// calling functionsfirstFit(partitions , size_partitions, processes , size_processes);bestFit(partitions , size_partitions, processes , size_processes);worstFit(partitions , size_partitions, processes ,…
1. Replace the (????) with relevant code to make th eprogram function. Details about the code are given below:(Java as been used) a) This program creates a reference to a file in main() and passes the reference to countWords() countWords(), not main(), reads the file and displays Total lines Total words Average words per line */ package finalexamtakehome1; import java.io.*; /** * * @author sweetkim */ public class Finalexamtakehome1 { // public static void countWords(????) { int lineCount = 0; int wordCount = 0; while (????()) { String line = input.nextLine(); lineCount++; Scanner lineScan = new Scanner(line); while (????()) { String next = lineScan.next(); wordCount++; } } double averageWords = (double) wordCount / lineCount; System.out.println("Total lines = " + lineCount); System.out.println("Total words = " + wordCount); System.out.printf("Average words per line =…
Java 1. Need a list of 30 words, phrases and company names commonly found in phishing messages. Assign point value to each based on your estimate of its likelihood to be in a phishing message (e.g., one point if it's something likely, two points if modereratly, or three points if highly likely). Do an application that scans a file of text for these terms and phrases. For each occurance of a keyword or phrase within the text file, add the assigned point value to the total points for the number of occurences and the point total. Show the point total for the entire message. 3. Do a word file answering these questions:Does your program assign a high point total to some actual phishing e-mails you have received? Does it assign a high point total to some legitimate e-mails you have received?
Q# When JUnit testing, which is the best practice? Group of answer choices When the method or constructor takes a numeric value, generate many random values for those values and test if all of them work. You only need to test three possibilities, positive values, negative values, and 0. Convert all numbers to String, and always compare those instead of the numbers themselves. Never test an input that will throw an exception, because you should never need to pass an invalid input to a method or constructor. Q# Suppose making a class Student, that will have fields and methods related to things a student might need to do, such as enroll in a course or drop a course. What should you do first? Group of answer choices Write the JUnit test for all methods of the class. Write the toString method. Implement the constructor. Think about what fields and methods you would like and make a class diagram. Q# Given a method with the signature:/*** Returns the minimum of the two…
1. The addElement() methods is used to add elements in vector at specific location. True or False? 2. Packages is a mechanism for naming and visibility control of a class and its content. True or False? 3. Exceptions handling in Java arises in code sequence during compilation time. True or False?
JAVA PROGRAM ASAP In the program dont use buffer reader, file reader, io exception, hashmap, map or scanner and please modify or create a new program ASAP BECAUSE hypergrade does not like the program down below and the progran does not pass all the test cases when I upload it to hypergrade. I have provided the correct test case as well as the failed test case as a screenshot. It must pass all the test cases because it says 0 out of 2 passed when I upload it to Hypergrade. The program must pass the test case when uploaded to Hypergrade. Thank you Chapter 9. PC #16. Morse Code Translator (modified *** Read carefully ***) Morse code is a code where each letter of the English alphabet, each digit, and various punctuation characters are represented by a series of dots and dashes. Write a program that asks the user to enter a file name containing morse code, and then converts that code to text and prints it on the screen. The Morse code table is given in a text file morse.txt. When…