28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.

28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.

Name: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry?b. Answer the same question for the anticodon sequence 5' xm³s²UAA.29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the gene

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
1. Although aminoacyl-tRNA synhtetases make few errors, occasionally an error. How can these error be detected and corrected? 2. Describe how the base pairing between the Shine-Delgarno sequence and the 30S subunit provides a mechanism for distinguishing a start codon form a methionine codon. What is the eukaryotic version of this mechanism?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.
1c) Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.
For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
1. A tRNA to which the correct amino acid has been attached is called?
The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?
Remembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith A in the wobble position? (Assume this A isalways modified to I.)b. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith U in the wobble position? (Note: Any singletype of tRNA with a U at the wobble position canbe modified only in a single way.)c. How might the wobble Us in each of the anticodonsin (b) be modified and still be consistent with thegenetic code?d. What is the theoretical minimal number ofdifferent tRNA genes that must exist in thehuman genome? (Assume that xo5U pairs with A,G, or U only.)
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution