4. What is the probability that an egg carrying an X chromosome will be fertilized by sperm carrying an X-chromosome? 00 O 1/4 01 0 1/8 O 1/2

Q: 70203 52000 CHIRAGRA SPIDER CONCH Harpago chiragra Linnaeus 1758 49+0

A: Introduction Characteristics of Mollusca are- 1. They are triploblastic. 2. They are bilaterally…

Q: Describe the relevance of Bioinformatics in supporting the progress of Biotechnology.

A: Bioinformatics:  Short for "biological Informatics", Bioinformatics is a new field of biotechnology…

Q: Why is it important for the sperm in internally fertilizing animals to undergo acrosome reaction at…

A: The acrosome reaction that occurs after sperm capacitation, is an exocytotic event induced by a Ca++…

Q: Which of the following would most directly disrupt formation of the adhesion belt? Group of answer…

A: Adhesion belt refers to the continuous band like structures formed between the adjacent cells.The…

Q: Not all prokaryotic cells have flagella. What are bacteria without flagella called?

A: Introduction:- Prokaryotic cells are characterized by absence of a well defined nucleus and membrane…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A: Principle of parsimony: The principle of parsimony is made use of when we need to determine which…

Q: 1a. What is the basic structure of a nucleosome? Also what's the key characteristics of histone…

A: Chromosome The highly condenced form of DNA chromatin fibres. These condensation is possible with…

Q: Answer the following 1. Why was Anton van Leeuwenhoek's discovery is important? 2. What is the…

A: Introduction: The natural world was finally explained by experiments and scientific observations…

Q: The alternation of generations life cycle applies to gymosperms in that: A. the gametophyte stage…

A: Gymnosperms are vascular plants that produce seeds but not flowers.

Q: Is there a way to solve without a scientific calculator?

A: Microbes can be destroyed or removed using physical means such as thermal treatment, radiation…

Q: How many species are present at year 1000? Justify your answer (i.e., clearly explain your…

A: The term species can be defined as a group of individuals that are able to inbreed. Speciation is…

Q: How do organisms with less complex systems such as those in protozoans are able to respond to…

A: Introduction Stimuli are detectable change in the internal or external environment.  which causes a…

Q: Minimize pipette handling Questions : How important is it to transfer the proper liquids in their…

A: Pipette is a safe method by which small amount of liquid can be transferred from one location to the…

Q: How does translation work? mRNA attaches to a The ribosome lines up complementary molecules. Their…

A: Protein synthesis is a process which occurs after transcription is completed. Transcription is a…

Q: How do potassium ions travel as they move into the cell?A.Up the concentration gradient and up the…

A: Introduction The cell membrane is a structure that surrounds the cell and keeps the organelles…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Q1: What is natural selection selecting for here? Q2: Why do bacteria that are not genetically…

A: Natural selection is the process in which the environment selects its organism naturally depending…

Q: Why is it said that photosynthesis and cellular respiration are reverse chemical processes?

A: Photosynthesis :-it is the process of production of food (oxygen and glucose) in the plants by using…

Q: Describe a series of experiments to SELECT and/or SCREEN for strains containing mutations that…

A: There is a chemical called styrene which is used in many industries to make latex, polystyrene…

Q: a) Use this data, and sketch a graph by hand that would best fit the data. (think which type of…

A: Aurelia  Aurelia commonly known as jellyfish because of its jelly like materials from which it is…

Q: how to perform a standard plate count.

A: The "standard plate count," a microbiological method, counts the number of bacterial colonies after…

Q: Which factor sets the upper limit of Chthamalus' realized range in the intertidal zone? O Ability to…

A: Introduction :- The area that is above water at low tide and below water at high tide is referred to…

Q: Which of the following statements is TRUE about phospholipids? The hydrophobic fatty acid tails on…

A: Phospholipids are amphiphilic molecules with hydrophobic fatty acid chains and hydrophilic moieties.

Q: What are the characteristics of a high-quality DNA extract? What do you do to determine the quality…

A: DNA extraction is a protocol used for the isolation and purification of DNA from biological samples…

Q: What are the limits to tree height and why?

A: The tree height is a tendency of the tree to become longer. Every tree tries to be as long as…

Q: Which ( somatic or gametes) are made in the process of meiosis?

A: Cell cycle is a series of events that are responsible for producing daughter cells from parent cell.…

Q: Which of the following statements are correct about cytoplasmic signaling in cancer cells? Multiple…

A: Metastasis is a significant cause of mortality worldwide. Cancer cells acquire genetic alterations…

Q: Which of the following statements describes the function of plasma membranes? I. define boundaries…

A: Plasma membrane is a microscopic membrane of lipids and proteins which forms the external boundary…

Q: What is similar among the following animals: chimpanzee, Rhesus monkey, dog, mouse, and rat. Are…

A: Different animals are classified on the basis of their morphological characteristics and…

Q: Construct a cladogram from the data below.

A: A cladogram is also termed "phylograms", these are used to infer the relationship between different…

Q: Why is it important to know if the bacteria is encapsulated or not?

A: Some bacterial cells are surrounded by a viscous substance called a capsule, which forms a covering…

Q: Pasteur used an S-necked flasks to disprove spontaneous generation. Explain the experiments that…

A: Spontaneous generation is a hypothesised theory that attempted to explain the origin of life…

Q: Question 15 of 17 Fill in the blanks: is the wavelength in nanometer used in spectrophotometric…

A: protein estimation is the process of quantifying the protein content of a sample. The protein…

Q: Identify the type of division exhibited by the following: Binary fission Algae (filamentous)…

A: Asexual reproduction The reproduction in which only single parent is required.

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Transport channel  The channel by which the molecules are transported across the membrane.

Q: Different recommended BMI ranges exist for people of different ethnic groups.  This is partially due…

A: Answer : True

Q: Match the following: Cleavage Gametogenesis Fertilization Blastula formation Formation of organs…

A: Developmental biology The study of process of development of animal and plants.

Q: why does DNA breathing occur?

A: Introduction: DNA serves as the template and substrate for many important biological processes,…

Q: Which of the following pathways would you expect to be inhibited by drugs that prevent import of…

A: Explanation: Since the import of proteins into the nucleus is part of the TGF-Beta signalling…

Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…

A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…

Q: Which of the following would be a properly identified and acceptable specimen? 1. needle biopsy…

A: The properly identified and acceptable specimen may include:  needle biopsy with patient's medical…

Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…

A: Species of organisms are distributed worldwide according to their adaptation ability and the…

Q: The difference in charge and chemical concentration across a membrane is known as Membrane gradient…

A: Electrochemical gradient is The gradient is made up of two components: an electrical gradient and a…

Q: Which of the following is the THICKEST? Right ventricle endocardium Right atrial epicardium Right…

A: * Heart is the main pumping organ in body.The function of heart is to pump blood throughout the body…

Q: B-lymphocytes convert into plasma cells, before they produce antibodies. Which of the following…

A: phagocytes, a type of living cell, devour or engulf other cells or particles through a process known…

Q: Identify three enzymes found in the body, their likely location inside the body, and the pH at which…

A: Enzymes are biocatalyst that perform specific chemical reaction. They are proteinaceous in nature…

Q: Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

A: The process of speciation is how populations develop into separate species. When populations are…

Q: Three risk factors of cancer.

A: Introduction  A group of diseases known as cancer involve abnormal cell proliferation and have the…

Q: substance that do not dissolve well in water are a. hydrophobic b. hydrophilic c.isotonic…

A: Introduction :- An substance that is attracted to water molecules and has a propensity to dissolve…

Q: QUESTION 4 Although physical features such as teeth are good for classification, only DNA can be…

A: Introduction :  A phylogenetic tree, also known as phylogeny, is a picture that shows how different…