QUESTION 4 Although physical features such as teeth are good for classification, only DNA can be used as data for phylogenetic analyses. True False

Q: Most restriction enzymes (RE's) were isolated from bacteria. Since these bacteria require an intact…

A: Restriction endonucleases are specific enzymes that cleave the DNA sequence by recognising and…

Q: Why are convergent traits considered evidence for evolution

A: Convergent evolution is the independently occurring evolution of comparable traits in animals from…

Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…

A: Antibiotic is a medicine that inhibits the growth of microorganisms or destroys it.

Q: In own words, give 5 or more reasons why most of the clinical features of the diseases…

A: Mitochondria are an essential component of eukaryotic cells, and their failure has been linked to a…

Q: Describe how a nuclear protein is made and transported to its final destination.

A: Proteins are 3-dimensional structures that are involved in various functions in our body. Proteins…

Q: If one extreme phenotype makes up most of a population after directional selection, what happened to…

A: Natural selection is a selective force acting against an organism to reproduce and survive because…

Q: In the late 1900s, two populations of bubble guppies became isolated from each other when a tsunami…

A: Introduction :- Temporal isolation happens when two populations reproduce in distinct seasons or at…

Q: Second messengers are molecules that relay signals received at receptors on the cell surface to…

A: Introduction :  The second messenger or intracellular hormonal mediator that carries information to…

Q: Provide examples and describe basic structure/function of plasma membrane components – Phospholipids…

A: Some cells, such as unicellular bacteria and protozoa, are complete creatures; others, such as…

Q: Put the following in order in mitosis and the preceding interphase Hint: Determine whether the event…

A: In eukaryotes, Cells divide either via mitosis or meiosis. Somatic cells divide via mitosis.…

Q: The diagram represents a possible phylogenetic tree showing the relationship between the four…

A: The phylogenetic tree is the diagrammatic representation of the evolutionary relationship of the…

Q: Describe the two possible versions of the traits for all of the characteristics you found in Pod…

A: Since you've asked multiple questions, we're answering the first three for you. If you want any…

Q: Illustrate simplified region (map) of the lac operon genes. Identify the genes present in this…

A: Lac operon is a control unit that consists of cluster of genes that helps in the metabolism of…

Q: Q .2    Provide a brief (2-3 sentences), but detailed, definition/explanation/identification of…

A: Human conduct has an impact on one's daily existence. Humans establish opinions about one another…

Q: In a particular animal, coat color is under the control of two interacting genes. Each gene has a…

A: Introduction:- Genotype is defined as the genetic constitution of an individual organism that…

Q: In the cells of honey badgers, DNA can be found in which compartments: Select one: a. cytosol b.…

A: DNA is the abbreviated form of the nucleotide polymer deoxyribo nucleic acid. It is the genetic…

Q: What will be the phenotypic ratio of the offspring of a purebreed male fly with eosin eyes (CCXw-eY)…

A: A phenotypic ratio is a quantifiable relationship between phenotypes that shows how often the…

Q: Briefly explain how protein breaks down in the body How do enzymes affect the proteins that we ate?…

A: Enzyme The protein molecules which act as catalyst in biological reactions.

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: sIMILARITIES AND  DIFFERENCES ecologist vs. environmentalist

A: Differences between ecologist and environmentalist: I) Ecologists are those who study ecology i.e.…

Q: Is this DNA extraction procedure needed/necessary for COVID19 screening? If not, what is its…

A: Because of the rapid spread and rising number of cases of coronavirus disease 19 (COVID-19),…

Q: Population divergence occurring as a result of females in a species consistently choosing males of a…

A: Population divergence is an evolutionary process by which the population of inbreeding species,…

Q: Q1: What would the white-fur-pigment allele frequency be if three of the homozygous black allele…

A: Allele pairings are categorised using the words homozygous and heterozygous. Homozygous individuals…

Q: If you gram stain an acid fast organism, what would you most likely see when you examine the stain…

A: * Gram stain is the procedure used to distinguish bacteria with different types of cell walls. *Acid…

Q: Describe the theory of evolution, and name two ways that you can see it at work

A: It is the process of change in the heritable traits of a population over time. The organisms which…

Q: Possible Symptoms of Diabetes Mellitus 1. Increased insulin production 2. Decreased insulin…

A: Diabetes mellitus Diabetes mellitus (DM) is characterized by increases blood glucose levels in…

Q: What are the sustainable development goals set by the United Nations, and how can you relate the…

A: Sustainable development : It is a type of development that deals with fulfills the need of present…

Q: Explain giving reasons the bending of the shoot tip of a plant towards light source coming from one…

A: When a plant bends towards the source of light this is called phototropism. It is the response of…

Q: Which is made in the reproductive organs?

A: Reproduction is the process by which new individual organisms are produced. Organisms of the same…

Q: Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5'…

A: Introduction :  The genetic code is a collection of rules that living cells use to decode the…

Q: in which way do cells use glucose during the production of ATP

A: The ability to accomplish work is defined as energy. While there are many different types of energy,…

Q: Suppose you had a sample that contained equal concentrations (in unit of mg/ml) of DNA and a…

A: Deoxyribonucleic acid (DNA) is a polymer composed of two polynucleotide chains that coil around each…

Q: Amylose Amylopectin

A: Introduction  The most prevalent carbohydrates in food are called polysaccharides, or…

Q: Which three proteins participate in movement of vesicles from the plasma membrane toward the…

A: Transport of macromolecules through vesicles:-  large molecules usually internalised by plasma…

Q: Two goats are mated together. One is tall and brown and of unknown genotype. The other is a short…

A: Introduction :  A test cross is defined as a cross which is used to test whether an individual is…

Q: Why does the population of S. aureus bacteria not pose a life-ordeath health threat outright?

A: The comprehensive research of microorganisms, whether they have one cell, many cells, or are…

Q: PDB could assist Dr. in her research endeavor. Explain how

A: Bioinformatics relates to the approach of using computer-related databases and algorithms to…

Q: Describe and discuss any two of the following chronic diseases. What are their risk factors? What…

A: The term "medical biology" refers to a branch of medicine that makes significant contributions to…

Q: Traits that are inherited and improve an individual’s ability to survive and reproduce are called…

A: Traits are defined as the idenfying character of an individual carrying several genetic…

Q: Different recommended BMI ranges exist for people of different ethnic groups.  This is partially due…

A: Answer : True

Q: What is the signaling pathway that mediates the organizing activity of the A/P organizer in the…

A: In Drosophila a morphogene i.e. DPP is responsible for the development of wing precursors. DPP gene…

Q: Estimate the chronic daily intake of 1,1,1-trichloroethane from exposure to a city water supply that…

A:

Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…

A: Genes are the hereditary units that control specific traits, different versions of these genes are…

Q: List the phylum for the species, and assign the following structures to the correct phylum and…

A: We are allowed to do upto three sub part of a question.  Please repost the undone questions again.…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A: Phylogenetic tree is responsible for providing the relationship between the taxons. It also provides…

Q: On average, how many mutations different are we from our parents? O only 1 or 2 O 10-30 O 40-50 O…

A: Mutations are the changes in DNA sequence. Based on the location of the mutation, it can be silent…

Q: QUESTION 1 An armadillo with the genotype Ee is used for a test cross. What is the genotype of the…

A: Explanation: The expression "genotype" alludes to the hereditary cosmetics of a creature; at the…

Q: Describe a series of experiments to SELECT and/or SCREEN for strains containing mutations that…

A: There is a chemical called styrene which is used in many industries to make latex, polystyrene…

Q: 3. We discussed seven points regarding the attributes of life. What are the 7 points and how do they…

A: Introduction:- Living organisms are made up of cells that performs the basic functions of life like…

Q: Possible answers for each: A) Both hormone and a neurotransmitter. B) Hormone. C) Neurotransmitter.…

A: Hormones only work  once they  "fit" a part of the body. That is, if cells  within the  target…

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.