40/ In eukaryotes, there 3 A. 59 codons code for amino acids, while 5 codons are stop B 60 codons code for amino acids, while 4 codons are stop C. 61 codons code for amino acids, while 3 codons are stop c D 60 codons code for amino acids, 2 codons are start codons 2 codons are stop codons none of the above is correct

40/ In eukaryotes, there 3 A. 59 codons code for amino acids, while 5 codons are stop B 60 codons code for amino acids, while 4 codons are stop C. 61 codons code for amino acids, while 3 codons are stop c D 60 codons code for amino acids, 2 codons are start codons 2 codons are stop codons none of the above is correct

Name: In eukaryotes, there49A. 59 codons code for amino acids, while 5 codo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In eukaryotes, there49A. 59 codons code for amino acids, while 5 codons are stopB 60 codons code for amino acids, while 4 codons are stopC. 61 codons code for amino acids, while 3 codons are stop cD 60 codons code for amino acids, 2 codons are start

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Similar questions

Why are 3 nucleotides needed for a codon? Because one nucleotide is redundant Because there are 3 different aminoacetyl TRNA synthetase enzymes Because there are 64 amino acids to code for, and 4X4X4 = 64 Because there are 20 amino acids, 3 nucleotides provides enough combinations to code for 20 amino acids
From the picture provided, which colored option (exon variant) will give me: 1. start codon 2. Stop codon Im not sure how to identify with exon out of the 15 exon varients provided which one has the start codon and which has the stop I need to filter these colored options in order to find my start codon and stop codon
Imagine discovering three different bacterial species on a meteorite. Each species contains genetic material that is not DNA, but the genetic material of each species contains four bases. Each species has a different number of amino acids. Use the total number of amino acids per species to determine the minimum codon length for each species.
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
Which of the following statements best explains why there are many more codons than there are amino acids? Group of answer choices Many codons are now considered "junk" codons The rules for base pairing between the third base of a codon and tRNA are flexible. Some tRNAs have anticodons that recognize four or more different codons. The DNA codes for all 61 tRNAs, but some are then destroyed.
The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.
Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
The nucleotide triplet AAA is the codon for Lysine. This codon originated from the following piece of DNA: 3’ – TTT – 5’. A) Illustrate the wobble hypothesis, listing an alternative codon for Lysine. List the newly created mRNA codon AND the mutated DNA sequence that was used as a template. B)Illustrate how this codon (AAA) could easily mutate into a STOP codon via a single nucleotide substitution. List the newly created STOP codon AND the mutated DNA sequence that was used for a template in this case.
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
Which of the following statements about a transition mutation in the sequence CGG is true? sequenceIt could result in a single base substitution to give the new codon CCG. It could result in a single base substitution to give the new sequence AGG. It could result in a single base substitution to give the new sequence TGG. A transition mutation in the sequence CGG would always be silent. It could result in a single base substitution to give the new sequence GGG.
Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)?Question 36 options: A) 3'-CUG-5' B) 3'-GAC-5' C) 3'-GAU-5' D) 3'-CUk2C-5' E) 3'-CUC-5'