Q: II. Provide drawings for a sample appropriate to a specific preparation technique and provide the…
A: The gram-staining technique is used to distinguish between gram-positive and gram-negative bacteria.…
Q: 50 In the diagram, which letter represents the enzyme -- AA .ВВ .cc -DD EE
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: What is DNA fingerprinting? what is its application/s (legally and medically) and limitation/s?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Water wisteria is an aquatic plant that is easy to care for and reproduces very quickly. A small…
A: Given : initial population size = 78 Number of new plants introduced daily = 15 Number of plants…
Q: Hb Erythrocytes Color index Reticulocytes Platelets Leucocyte s Neutrophils: 85 g/L 3,1*10¹2/L - 0%…
A: Acute myeloid leukemia Acute myeloid leukemia (AML) is defined as ≥20% myeloblasts,. (Here blast…
Q: ww20 In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The…
A:
Q: 63 Neonatal hyperbilirubinemia is usually treated with phototherapy, resulting in prompt reduction…
A: Introduction Jaundice is an illness in which a high level of bilirubin, a yellow-orange bile…
Q: Cellular Respiration and Fermentation cellular respiration can occur with (aerobic) or without…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Question 19 Proteins are made in the mitochondria of cells. True O False
A: Proteins are the macromolecules which are basically the polymer of amino acids.Proteins play very…
Q: Mouse tail length is controlled by 3 gene pairs. The longest possible length is 93 mm…
A:
Q: One of these material not a fixative O formalin O bouns floud O benzen O methanol
A: Fixation is process in which cells or tissue are fixed in physical state and partly in chemical…
Q: 45 As the cerebral cortex differentiates, fibers passing to and from it divide the corpus striatum…
A: Introduction In humans and other mammals, the cerebral cortex, also known as the cerebral mantle,…
Q: Match each antibacterial drug with its primary target. Chloramphenico✓ Choose... Nucleic acid…
A: Sol: Antibacterial drug is chemical substances which are obtained from biological source or produced…
Q: Living organisms play an important role in the recycling of many elements within an ecosystem.…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: drying at critical point It is used in scanning electron microscopy O true false
A: Introduction: The critical point drying approach is an effective way to dry sensitive materials for…
Q: For many enzymes, it is important to exclude water from the active site. Explain in your own words…
A: Enzymes are proteins produced by living organisms to catalyze specific metabolic and biochemical…
Q: Provide background information on zanamivir (antiviral drug) and determine the mode of action. Be…
A: INTRODUCTION Zanamivir Zanamivir is an antiviral drug used to treat influenza caused by Influenza A…
Q: A Spleen B
A: The given pic shown is of the dissection of the male frog showing some part of the reproductive…
Q: Question 1 Glucose belongs to this type of carbon compounds O A lipids OB. carbohydrates OC.…
A: The living organisms contain different biomolecules between which proteins, carbohydrates, lipids…
Q: paraffin wax very important material in histological and histopathological study O true O false
A: Paraffin wax is used in the histological and the histopathological studies for embedding the…
Q: specific organism representative of the group you chose, gather information about it, and identify…
A: Cleansing agents Cleansing agents are defined as the chemical compounds or substance that works by…
Q: In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The relative…
A: Introduction: In the absence of evolutionary mechanisms, the Hardy-Weinberg principle states that…
Q: What is the scientific process
A: Introduction Any system of knowledge concerned with the physical world and its phenomena that…
Q: Discuss the differences between humoral and cell mediated immunity in terms of chemicals and cells…
A: In Biology, humoral alludes to any process that relies upon the creation of bodily humor like, for…
Q: food label analysis
A: Food labels Food labels are also called the nutritional fact labels as they represent the…
Q: Give FOUR criteria for identifying a substance as a neurotransmitter.
A: Introduction A neuron releases a signalling chemical called a neurotransmitter across a synaptic…
Q: In terms of the history of microbiology, which of the following matches is NOT correct? A. van…
A: Antony van Leeuwenhoek was the first person to observe a microorganism, he used a microscope made by…
Q: How does the carbon dioxide move out of cells without energy and into the bloodstream?
A: Introduction Gas exchange is a physical process in which gases diffuse across a surface in a…
Q: metachromasia Means O Certain stains change the coloration O differente stains O different from the…
A: Introduction: Mast cells, for example, contain the sulphated acid mucopolysaccharide heparin, which…
Q: WHAT ELSE CAN I ADD TO THIS: A hypothesis is "a proposed explanation for a set of observations. A…
A: Introduction The hypothesis is a supposition or proposed explanation made on the basis of limited…
Q: all dicot seeds have endosperm
A: Most flowering plants (Angiosperms) are of 2 different categories which include Monocots and dicots.…
Q: Scientists are concerned that bacteria will be resistant to all antibiotics within the next decade.…
A: Microbes develop methods to defend themselves against the effects of antimicrobials, which is known…
Q: 92 A 45-year-old woman is brought to the emergency department because of a 3-hour history of severe…
A: The biliary tract connects the gallbladder to the rest of your digestive system via a series of bile…
Q: In what two major classes can all neurotransmitter receptors be divided? What are the main…
A: Introduction Neurotransmitter receptors, also called neuroreceptors, are membrane-bound proteins…
Q: 73 A 54-year-old man undergoes successful rubber band ligation of a prolapsing hemorrhoid Four weeks…
A: Introduction Hemorrhoids are swollen and inflamed veins that produce pain and bleeding in the…
Q: The theory of evolution by Darwin is a composite theory, i.e. it has five component theories: 1.…
A: The theory of evolution was found on the assumption that all species are connected and evolve over…
Q: gamsas stain its mixture if two stains O true O false
A: Giemsa stain named after German chemist and bacteriologist Gustav Giemsa, is a nucleic acid stain .
Q: Compare and contrast the interrelationships between anabolism and catabolism. Be sure to mention…
A: Introduction Anabolism and catabolism are the two important sets of reactions in metabolic…
Q: How does energy flow through a biological community?
A: Introduction Ecology is a discipline of biology that studies how living things interact with their…
Q: explain the results of the experiment effect of the temperature and pH on amylase temperature
A: Answer :- Results 1) effect of temperature It takes less time to succeed in uncolored purpose at…
Q: Which jumping variation would result to the lowest jump height, average jump height, and highest…
A: Jumping is defined as pushing oneself upwards from the ground, against the force of gravity. Jumping…
Q: What might cause different soils to develop from the same kind of parent material or similar soils…
A: Introduction :- The loose surface layer that covers the majority of land is known as soil. It is…
Q: Mechanical part of microscope O Body of microscope O arm O base all of thom
A: There are different parts of the microscope Mechanical parts - • Base • Arm ( C-shaped ) •…
Q: 11 12 13
A: Frogs are amphibians and have aquatic and land life.
Q: 85 __________ is the sequence motif located downstream from the Inr core promoter motif. A. BRE b.…
A: 85 __________ is the sequence motif located downstream from the Inr core promoter motif. A. BRE b.…
Q: . List the other possible mechanisms of cell damage. Is it possible to restore the number of blood…
A: Radiation sickness Radiation sickness is a result of being exposed to a high dose of radiation in a…
Q: n a table, illustrate the differences between natural, artificial, active and passive immunity with…
A: Microorganisms are always surrounding humans, looking for an opportunistic host. These viruses have…
Q: A 4-year-old boy has massive nosebleeds, post-traumatic ammations of the knee and elbow joints,…
A: In a normal person when an injury occurs the blood is lost and this blodd is cogulated. This is…
Q: 94 In the arrested state (7-14 nucleotides) of elongation, ( ) is required to reactivate…
A: In molecular biology, the central dogma explains a lot about the transcription and translation in…
Q: Fill in the blanks: Identify pointed structure A A
A: Dissection is the method of cutting the deceased animal or plant for studying the anatomical…
Step by step
Solved in 3 steps
- 1. By use of a labeled diagram or a written description, distinguish the roles of thefollowing in elongation of a polypeptide: initiation complex, charged tRNAs, peptidyltransferase, Site A, Site P 2. What determines the initiation of translation? (Hint: there is more than one feature oftranslation.)13c give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with including wobble matches3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
- I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper discribtion what is happening in translation? In my texxbook it is explaing that mrna goesto rrna and rrna is the maker of the amino... or am I misunderstanding?PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSEnergy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
- A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)The Second Genetic Code Review the evidence establishing that aminoacyl-tRNA synthetases bridge the information gap between amino acids and codons. Indicate the various levels of specificity possessed by aminoacyl-tRNA synthetases that are essential for high-fidelity translation of messenger RNA molecules.A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
- The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the given.A _____________________ is a purine-rich sequence closeto AUG (the initiation codon) on a prokaryotic mRNA thatbinds to a complementary sequence on the 30S ribosomesubunits, thereby promoting the formation of the correctpreinitiation complex.
