40. What is the pointed structure of the frog? a. Tendon of achilles b. Peroneus c. Gastrocnemius d. Tibialis anticus

Q: discuss the following statement: “Whether the ΔG for a reaction is larger, smaller, or the same as…

A: Gibbs free energy is defined as the energy that is available to do work. This is the work done in a…

Q: Formulate a working hypothesis through if and then statement about using intangible model in…

A: Enzymes are protein molecules acting as biological catalysts that are able to accelerate the rate of…

Q: CONCENTRATION (NG/ ML) ABSORBANCE 655 NM (AU) 0.695 0.699 1000 500 250 0.587 125 0.513 63 0.385 31…

A: ELISA stands for enzyme-linked immunosorbent assay. It is a commonly used bio-chemical assay, that…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Which of the following gene expression regulatory mechanisms saves the most energy but takes the…

A: Post-translational control- this mode involves modification of an already synthesized protein. it is…

Q: O 500 animals O 610 animals O 450 animals O Not yet at K O 200 animals

A: In biology, growth curves are commonly used to represent things like population size or biomass, as…

Q: True or False: 1. Amino acid chain elongates when the AA from the peptidyl binding site is added to…

A: The translation process is started by ribosomes. Ribosomes are made up of bigger and smaller…

Q: A prominent chin is typical of______ . a. Homo sapiens c. Homo erectus b. Homo habilis d. Homo…

A: Gibbons, Orangutans, Gorillas, Chimpanzees, and Humans are classified as hominoids.

Q: Margarine is made from vegetable oil by a chem-ical process. Do you suppose this process converts…

A: Margarine is a flavouring, baking, and cooking spreading. It's most commonly used as a butter…

Q: For the Photosynthesis procedure, you will be detecting if photosynthesis occurs in Elodea plants…

A: Plants with chloroplasts do photosynthesis and produce food .

Q: Name the different components (a-g) and functions of the Ebola virus shown below. Please write the…

A:

Q: Describe the roles played by Louis Pasteur and Robert Koch inunderstanding infectious disease; list…

A: Infectious diseases are the diseases caused by bacteria, viruses, fungi or parasites.Generally many…

Q: make glucose and the oxygen is released as molecular oxygen.        If you do the math how much…

A: In photosynthesis green plants use energy from sunlight  to convert atmospheric carbon dioxide and…

Q: How do you feel about GMO foods th

A:

Q: What are the sensory inputs to skeletal muscles and associated structures

A: Musculo skeletal system is one of the major organ systems of the body.Skeletal muscles are attached…

Q: 1. Explain why there are some organisms that survive and there are some organisms that does not…

A: Introduction :- An organism is any organic, living system that functions as a separate entity in…

Q: Topoisomerase

A: The main function of the topoismerases 1 is to unwind or remove the supercoils in the DNA that can…

Q: 1. What is the significance of use of potato in the preparation of culture media? 2. What is the…

A: To identify the microorganism, it must first be placed into a medium to commence development, and…

Q: Bacteria that thrive in puncture wounds are likely to be (a) aerobes (b) photoautotrophs (c)…

A: Aerobes are the organisms that live and reproduce only in the presence of free…

Q: You are doing experiments in a lab to test a potential new drug (you are calling it “relaxomere”)…

A: experiments in a lab to test a potential new drug for “relaxomere” for the treatment of…

Q: The canonical DNA polymerase are the main DNA synthetic enzymes in human cells and they carry out…

A: DNA polymerase is the enzyme which found in every cell. It is a holoenzyme which have different…

Q: How is the photic energy absorbed by chlorophyll transfered to ATP molecules in…

A: Photons of light energise the electrons in the chlorophyll molecule. The electrons are attracted by…

Q: Which of the following is the correct sequence for RNA splicing: 1. U2 binds to the branch site and…

A: Interaction of the U1 snRNP to the 5′ splice site (5′ ss) and engagement of splicing factor 1 and U2…

Q: True or False: 1. There is a reduction in the length of the DNA after every round of replication.…

A: The heterocatalytic process by which a new DNA strand is synthesized on a old DNA template is known…

Q: Discuss, the adaptations that downy mildew (plant) has evolved to invade and manipulate the hosts…

A: Downy mildew  Is a fungal infection. Causative agent : phylum Oomycota    Environmental condition…

Q: Periodic and systematic assessment of health risk status classifies patients into specific…

A: To speak out for potential clients when choices concerning healthcare resource allocation are being…

Q: Question 34 The diarrhea (loose and watery stool) that is a symptom of diseases like cholera is due…

A: Gallbladder is basically associated with digestive system and helpful in storing the bile juice…

Q: Explain the evolutionary relationship between the fin of a fish and the flipper of a whale.

A:

Q: Differentiate the following treatments based on the effect of light on monggo (Vigna radiata) seed…

A: Monggo (Vigna radiata) is also called as Mung bean. And this grows differently to different exposure…

Q: a. If a couple had more than one child, would all the children have the same bands as the first one?…

A: Possessing of genes in a child is random though it has the genes of both parents .

Q: Question 32 The primary functions of the spinal cord are O local control and decision-making for…

A: The long, thin, tubular bundle of neurons and supporting cells that originate from posterior end of…

Q: Question 17 Osmosis is the movement of across a selectively permeable membrane. O sugars O oxygen O…

A: Introduction Semipermeable membrane:- It is a type of biological or synthetic, the polymeric…

Q: Yellow and black coat in cat appear to be controlled by a pair of sex-linked alleles…

A: Sex-linked traits:            Traits that are controlled by genes present on sex chromosomes are…

Q: Primaquine is a drug used in the antimicrobial prophylaxis of: O Meningitis O Tuberculosis Malaria O…

A: Answer :- Option (C) is correct. - Malaria.

Q: The prime source of chlorofluorocarbons is A. Vehicular emissions B. Industrial effluents C.…

A: Introduction - Fully or partially halogenated hydrocarbons containing carbon, hydrogen, chlorine,…

Q: process of going from the DNA base pairs of TAC to the amino acid methionine on a polypeptide.

A: Genes and protein synthesis Genes are the basic hereditary unit that is responsible for transferring…

Q: True or False: 1. There is the bidirectional mode of replication during S-phase.  2. Single strand…

A: The replication is the process of new DNA synthesis from the old DNA template by semiconservative…

Q: 2. Hemoglobin releases protons upon oxygen binding. This phenomenon is called the Bohr effect, and…

A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…

Q: All the body systems work together to maintain homeostasis in the organism. No organ system operates…

A: Introduction :- Large insoluble food molecules are broken down into small water-soluble food…

Q: How does the activity of human p53 get regulated through the interaction of the transactivation…

A: p53 is basically a transcription factor that helps in suppressing the growth of the tumor. This…

Q: True or False: 1. In DNAs, the amount of adenines always equal to the amount of thymine and…

A: DNA It is a nucleic acid molecule which constitutes two polynucleotide chains wound around each…

Q: hemoglobin

A: Hemoglobin: Hemoglobin is a type of a globular protein present in the red blood cells which…

Q: What kind of cleavage pattern characterizes snail development? Describe its orientation.

A: Snails, earthworms and flatworms are remarkably different animals, but they all exhibit a very…

Q: Penicillin obtained from a fungus is : A. Antibiotic B. Antiseptic C. Antibody D. Antiserum

A: Penicilin obtained from  Penicillium notatum  . It is a type of antibiotic . It kills bacteria…

Q: 2. How does the key below the pie chart help you to better understand the pie chart? 3. How does the…

A: Extinction is defined as the termination of any kind of organisms due to environmental forces or due…

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: Penicillin G is an antibiotic that is used to treat bacterial infections. Pneumonia, strep throat,…

Q: CASE 1: A dying patient is experiencing agony and there is no medical relief available. Her life can…

A: Euthanasia: Euthanasia is the deliberate ending of a person's life in order to relieve pain and…

Q: Primase has the important role of removing the RNA primers and filling the gaps with new DNA…

A: DNA replication There are number of processes necessary for the continuation of generation, growth…

Q: In guinea pigs, rough coat is dominant (R) to smooth coat (r), and black coat (B) is dominant to…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Which statement describes Linus Pauling's contribution to the understanding of DNA structure? a…

A: The following statement describes Linus Pauling's contribution to the understanding of DNA structure…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.