A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC 3' 3 TCGATCAGGCCTAGGCTCCCGGGAAGAGTACTCTAGGCCTACTGG 5' Yes From the following restriction enzymes, which one(s) can cut the fragment? JelO II No v, PankI No MilKI Yes v JelO II 5' TCATGA 3' 3' AGTACT 5 Pank III 5' CTAG 3' 3' GATC 5' MilK I 5' GGGCCC3' 3' C CCGGG 5

Q: Distinguish between positive and negative control. Give examples of each from the lac operon

A: Operator is a unit consisting of one or more cistrons that function coordinately under the control…

Q: Genetic problems: Use the diagram below to figure out how each monosomy or trisomy can a) Normal X…

A: 1) Trisomies and monosomies are two types of chromosomal abnormalities. Specifically, a trisomy is…

Q: Fruit flies infected by fungi are protected by drosomycin and when infected by bacteria are…

A: Drosomycin is a peptide against the fungus infectant when it infact the Drosophila melanogaster or…

Q: The ability of oxygen to bind hemoglobin changes with altitude as shown. Which statement, if true,…

A: The binding of oxygen and heamoglobin depends on the partial pressure of oxygen in the body and In…

Q: QUESTION 25 What is the value of identifying prevalent base changes found in different cancer types?…

A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…

Q: A. Complete the table below by filling in the information you have learned from the concept on the…

A: Cell is the structural and functional unit of life.  Cell can be prokaryotic (without nucleus) or…

Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…

A: Several types of techniques are incorporated in the molecular biology to get more desirable results…

Q: Please draw a diagram that shows the interactions among biotic components of the savanna ecosystem.

A: A savanna ecosystem consists of mixed woodland and a grassland ecosystem. It is distinguished by…

Q: Please help Why did we use nanoparticles?

A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…

Q: Does sexual selection have the potential to accelerate speciation, please provide an example..

A: Sexual selection has a reputation as a major cause of speciation, one of the most potent forces…

Q: Describe the process of Translation of mRNA to DNA.

A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…

Q: Describe the behavioural and physiological adaptations that enable many rodents to thrive in arid…

A: Introduction "Adaptation is a physical or behavioural trait of an organism that aids in the…

Q: What are some general similarities in how receptive fields are represented by the nervous system?…

A: Receptive field is a region in the sensory periphery within which stimuli can influence the…

Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…

A: The process of urine formation is done in the nephrons present in the kidneys. The nephrons are…

Q: Purified proteins can have their mW determined by: Ethanol precipitation O SDS-PAGE O going to taco…

A: The application of scientific and technical principles to the processing of the material by…

Q: SARS-CoV-2 was shown to be transmissible even when the carrier has no symptoms. How did this…

A: SARS virus is a positive strand RNA virus and belongs to coronavirus family.

Q: Describe the process of DNA replication of the leading strand?

A: ANSWER;-

Q: Describe in your own words primary and secondary active transport in detail.

A: In cellular biology, Active Transport refers to the movement of molecules across a membrane across a…

Q: A sealed greenhouse that allows sunlight through the windows but prevents water or vegetation from…

A: A greenhouse is a self-designed structure having walls and roofs made up of transparent materials…

Q: What are the physiological changes that can occur when an individual adds resistance training to…

A: Introduction Resistance training is any exercise that causes the muscles to contract against an…

Q: You are recording from a touch receptor in skin. When you stimulate a spot on the skin, the receptor…

A: Answer :- Option (B) is correct. - Whether the receptor sends its output to the somatosensory cortex…

Q: What is diabetes mellitus? Differentiate between Type I and type II diabetes

A: Introduction :- A condition in which the body's glucose (a type of sugar) levels are out of control…

Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: (A) MRE (в) GC Box c) GRE D…

A: Introduction Metallothionein is a protein that has a high affinity toward binding heavy metal ions,…

Q: What if the continents did not move, how could you explain disjunct distributions?

A: Introduction A taxon with a disjunct distribution is one that has two or more groups that are…

Q: Explain why the RTK signaling pathway includes the extra complication of having a protein (Ras) that…

A: Ras is a tiny GTP-binding protein that is part of the signal transduction pathway that growth…

Q: What are the environmental climatic and bio-physical requirements of lowland rice

A: Answer :- Rice crop needs a hot and humid climate. It is the most appropriate to districts which…

Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…

A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…

Q: TRUE or FALSE? Sexual selection can only occur if the features and/or behaviors associated with it…

A: Natural selection is the interaction through which populaces of living beings adjust and change.…

Q: (a). What is the role of calcium ions and troponin during contraction in striated muscles of hum

A: Introduction - Myofibrils, which contain a specialised protein (myoglobin) and chemicals to deliver…

Q: Urinary system lab assignment and related case study Leo, 37-years old was absolutely shocked when…

A: Introduction The kidneys, ureters, bladder, and urethra make up the urinary system, often known as…

Q: Question 27 To make RNA the nucleic acid sequences get read in the directi -- Sense → Antisense O…

A: Nitrogen-containing bases, phosphate groups, and sugar molecules make up nucleic acids. Each nucleic…

Q: Give economic and ecological significance of Corn (Zea)

A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…

Q: If you cloned GFP under the control of the V. fischeri Lux promoter, when would you see GFP…

A: Vibrio fischeri exhibits bioluminescence only when the density of its cell is higher and…

Q: Explain the neutral theory of molecular evolution (20%) and how you use it as a null hypothesis to…

A: There are multiple evolutionary terms that helps in establishing a role in the molecular evolution.…

Q: Generally, one single mutation is enough to cause cancer. [Select] Cancer-causing mutations cause…

A: When the genes that control cell division are disrupted, cancer cells are produced. Carcinogenesis…

Q: True or False The physical life is always greater than all the other “life” factors under…

A: Answer: false because the physical life is not always greater than aal the other life factors under…

Q: D E- F- Zygomatic Arch Dental Arcade Foramen Magnum Occipital Condyle Occipital Bone [Choose ]…

A: The skeleton of the head is called the skull. It consists of several bones that are joined together…

Q: Which of the following is considered to be a spontaneous source of mutations that impa the genome? O…

A: ANSWER) (a) Fidelity errors during replication Spontaneous mutation is described as the alterations…

Q: Anther Filament- Banner -Wing Peta Keel petal

A: A flower contains two types of reproductive parts : Female: Stigma, Style, Ovary (Pistil) Male:…

Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%.  What…

A: Hardy-Weinberg provides the null hypothesis that links the alleles and the genotypes in the…

Q: Climate change, water and politics are 3 of the 10 fundamental environmental issues. Select one: O…

A: Earth is currently facing a lot of environmental concerns. The environmental problems like global…

Q: 2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose…

A: DNA replication is semiconservative in nature, where each daughter DNA molecule has one parent…

Q: Which of the following features is NOT helpful in determining the start site of a gene?…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: In most populations, population size remain near the carrying capacity as long as limiting factors…

A: Limiting resources are considered as the carrying capacity for any population.

Q: which protein consists mainly of a helixes  a. hemoglobin     d collagen b cotton               e…

A: The structure of proteins is organized at four levels. The primary structure shows the sequence of…

Q: Equipment or materials used in immobilizing and separating cells of streak, pour and spread method.

A: Answer :- We need to understand one by one are as follow :-  * Equipment or materials used in…

Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…

A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…

Q: How does temperature and PH affect the activity of enzymes.

A: Introduction - Enzymes are proteins that help a person's body's metabolism, or chemical reactions,…

Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…

A: Answer :- Option (C) is correct. - Insulin receptor phosphorylation increases insulin secretion.

Q: DNA photolyase- strain of E. coli

A: Photolyase is an enzyme that repairs DNA that has been damaged by ultraviolet light. These…