5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can change the amino acid structure of a protein the associated mRNA would read 5' AGG CCT AAG TTC CCT CAC ACA CAC AGG A 3' This piece of DNA will produce a protein with 9 Amino acids the associated mRNA would read 3' AGG CCT AAG TTC CCT CAC ACA CAC AGG A 5' the primary structure of a protein is directly related to the sequence of amino acids Letter A = The Template strand There is a stop codon in the mRNA but there is not a start codon the start codon is the 3rd codon
5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can change the amino acid structure of a protein the associated mRNA would read 5' AGG CCT AAG TTC CCT CAC ACA CAC AGG A 3' This piece of DNA will produce a protein with 9 Amino acids the associated mRNA would read 3' AGG CCT AAG TTC CCT CAC ACA CAC AGG A 5' the primary structure of a protein is directly related to the sequence of amino acids Letter A = The Template strand There is a stop codon in the mRNA but there is not a start codon the start codon is the 3rd codon
Biology Today and Tomorrow without Physiology (MindTap Course List)
5th Edition
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cecie Starr, Christine Evers, Lisa Starr
Chapter7: Gene Expression And Control
Section: Chapter Questions
Problem 7SQ
Related questions
Question
Correct answers
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 5 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning