TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

A: Transcription is process of copying a DNA segment into RNA.

Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…

A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: Describe the process of transcription. Your answer should be at least a full paragraph (3-7…

A: Question - Describe the process of transcription. Your answer should be at least a full paragraph…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding…

A: Since we know in RNA Thymine is replaced by Uracil. So Adenine is binded to Uracil. This forms the…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: What's the mRNA sequence for TACATCTTGGCGACGACT

A: mRNA is a single-stranded RNA that developed during the transcription in a cell. This is also known…

Q: 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA…

A: The translation is the process by which the information on the mRNA is transferred into appropriate…

Q: CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype

A: The process of synthesis of RNA with the help of template DNA is called transcription. In this…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so,…

A: The RNA is formed from the DNA by the process of transcription. The protein is formed from the RNA…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: What will be the next amino acid added to the growing polypeptide chain?

A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript…

A: The sequence of three RNA or DNA nucleotides that corresponds to a particular amino acid or stop…

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…

A: Translation Process by which the mRNA codes for a particular protein is known as translation.

Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.

A: The givem template sequence is as follows,  TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…

Q: decode the following mRNA strand into the appropriate amino acid sequence (assume the first 3…

A: m-RNA undergoes translation to form proteins. The correct form of the amino acid sequence is 5’- AUG…

Q: 5 T G T T A G T C G A A T 3  what is the complimentary dna and complimentary mRNA

A: DNA is genetic material which consists of two types of strands . A ) Template strand  B ) Coding…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: As per the central dogma of molecular biology information stored within the DNA is transcribed onto…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: Original sequence Altered sequence protein/ amino acid mutation: DNA nucleotide AUUCGAGUA AUUCGGGUA…

A: A mutation is a sudden, stable and inheritable alteration in the base sequence of a gene which is…

Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype

A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

A:

Q: Translate the protein that is expressed from this template DNA sequence. Transcription is going left…

A: Transcription is the process of formation of mRNA from a DNA transcript. It occurs ont he template…

Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

A: CAT  CTA  CAA  ATA  GCA  CCT  AAT  TGT  G           (DNA)

Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…

A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…

Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…

A: Mature mRNA or mature transcript is the RNA present in eukaryotes  which consists of exons with all…

Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…

A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…

Q: 5'-AGA-ACT-AAA-CTA-TCG-CTT-CGT--3'   mRNA: original protein

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: What is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A.…

A: Introduction: Amino acids are biomolecules that contain two functional groups that are amine and…

Q: Transcribe the following DNA template into its mRNA sequence. COMPLEMENTARY DNA Messenger RNA(mRNA)…

A: Nucleic acids are polynucleotides that are of two types i.e. DNA and RNA. A nucleotide is composed…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: During protein synthesis, the nucleotide sequence of the mRNA is read in the form of triplets.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.