Please help me with these questions, more than one answer may be correct for each: The above figures are showing the results BMAL1 gene knockout on the GFR and blood aldosterone in a mouse model over a 24-hour period (12h light, 12h dark). ZT stands for Zeitgeber times, which is simply the number of hours since the beginning of the light period in the day. GFR (dashed lines) was tested for a match to the modeled circadian cycle (solid line in top figure), and a p-value < 0.05 indicates a significant match (both control and knockouts were tested against the same modeled circadian cycle). Significant differences between control (black) and knockout (red) mice blood aldosterone are marked with stars. 1) Genes/proteins that one could knockout that would likely have a similar effect include: H ATPase NA/K ATPase PER Anion exchanger Cryptochrome 2) According to the figures above, knockout mice appear to: have higher aldosterone production lose circadian rhythmicity to GFR live longer lives have lower aldosterone production have higher GFR

Please help me with these questions, more than one answer may be correct for each: The above figures are showing the results BMAL1 gene knockout on the GFR and blood aldosterone in a mouse model over a 24-hour period (12h light, 12h dark). ZT stands for Zeitgeber times, which is simply the number of hours since the beginning of the light period in the day. GFR (dashed lines) was tested for a match to the modeled circadian cycle (solid line in top figure), and a p-value < 0.05 indicates a significant match (both control and knockouts were tested against the same modeled circadian cycle). Significant differences between control (black) and knockout (red) mice blood aldosterone are marked with stars. 1) Genes/proteins that one could knockout that would likely have a similar effect include: H ATPase NA/K ATPase PER Anion exchanger Cryptochrome 2) According to the figures above, knockout mice appear to: have higher aldosterone production lose circadian rhythmicity to GFR live longer lives have lower aldosterone production have higher GFR

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter16: Adult And Pediatric Dosages Based On Body Surface Area

Section: Chapter Questions

Problem 5.4P

See similar textbooks

Similar questions

The mouse thymus normally contains about 1–2 ´ 108 thymocytes, the vast majority of which are CD4+CD8+ (double-positive) cells. When thymocytes from mice with a gene deficiency in the TCRa locus are compared with those from TCRb-deficient mice, a striking difference between the two different knockout lines is observed, as shown in the figure below in a simplified version of flow cytometry data. The numbers of thymocytes in each thymus is indicated below the plots. What is the explanation for the difference in thymocyte subsets and cell numbers observed when comparing TCRa-/- to TCRb-/- thymocytes? Which region of the thymus organ would show a dearth of developing thymocytes in the TCRa-/- thymus? Which region in the TCRb-/- thymus?
From the MW analysis; are any of the gel and immune-detected bands consistent with what you expect for IgG? Are the gel and immune-detected bands suspected to be IgG consistent in distance migrated with to with respect to the molecular ladder? What is the difference between the whole calf serum and the “purified” lanes? Were we able to truly purify IgG with the magnetic bead protocol?
Regarding the production of recombinant monoclonal antibodies, it is CORRECT to state that: * (JUST ONE STATEMENT IS CORRECT) (A) Chimeric and humanized antibodies differ in relation to the percentage of sequence of the constant chain of molecules from the human genome (B) Chimeric antibodies are industrially produced by joining purified protein fragments of the Fab fraction of murine antibodies and the constant portion of human antibodies. (C) When using cells dependent on the DHF amplification system, we must use a vector containing the coding information of the light and heavy chains and another vector that contains the coding sequence of the enzyme dihydrofolate reductase (D)The industrial purification of monoclonal antibodies should preferably use an initial step based on the use of affinity columns, which will bind the antibodies by the Fc fraction (E) The use of amplification systems such as GS and DHFR has as main objective to make the production of monoclonal antibodies…
Based on your molecular weight predictions from computational analysis of the DHFR fusion proteins analyzed this semester, what would you estimate the molecular weight of the GST tag used to be?
Since the query’s are matching does that mean the house mouse( mus musculus) is a good model to test in the human FGFR3 gene(achondroplasia). The NCBI blastp and reciprocal analysis are below
Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation
Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?
Based on the NCBI blast below Are there any pathogenic missense mutations in the human gene FGFR3? Also do they have any identical amino acids to prove a mouse is the best model to test the fgfr3 gene?
Below is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…
Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA
BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018. Give an example of a technique that can be used to measure the affinity of the antibody for Factor 801A? Explain how it works David adds that an…
BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal antibodies made in insect cells. The CEO, Dr. Bugsbunny, has convened a Board Meeting to discuss research proposals and budgets. The VP of Research & Development, Karen Hucklebug, gives an update on the Factor 801A program. Factor 801A is new signal transduction molecule that is important for the growth of ovarian cancer cells. She explains that the structure of the antibody binding to 810A has been finalized and production is on schedule in Luv Bug, Ireland. The CMO, Dr. David Sprayberry, reminds the Board that several pathologists have reported high levels of Factor 801A in ovarian cancer cells and it is a significant prognostic factor. The American Cancer Society estimates that 14,070 women died of ovarian cancer in the United States in 2018 Propose a protocol (~100 words) to study the efficacy of the antibody in this mouse model.